Unlock instant, AI-driven research and patent intelligence for your innovation.

Metallic cadmium resistance associated protein KdpD and coding gene and application thereof

A technology related to resistance and encoding genes, applied in the field of genetic engineering, can solve problems such as unclear

Inactive Publication Date: 2012-04-18
SUN YAT SEN UNIV
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] However, so far, what role the KdpD gene plays in the resistance to heavy metal cadmium in microorganisms is still unclear, and there is no report of cloning the KdpD gene from AMD microorganisms.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Metallic cadmium resistance associated protein KdpD and coding gene and application thereof
  • Metallic cadmium resistance associated protein KdpD and coding gene and application thereof
  • Metallic cadmium resistance associated protein KdpD and coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1 Cloning of the complete sequence of DbsATPase gene

[0026] 1. Field microbial sample collection

[0027] Acid mine wastewater (AMD) at different acidification stages (pH 2, 4, 6) was selected from the Yunfu lead / zinc mine in Guangdong, and cells in 20L AMD were collected using a 0.22 μm filter membrane. In order to maintain the integrity of the nucleic acid, save the samples and freeze them in liquid nitrogen, bring them back to the laboratory within 24 hours, and store them in a -70°C refrigerator for long-term storage.

[0028] 2. Extraction of Nucleic Acids

[0029] The EST method was used for DNA extraction, and the process was as follows: add lysozyme and proteinase K to the SET buffer, digest for 30 minutes, centrifuge at 15,000 rpm for 15 minutes, extract twice with chloroform, precipitate with isopropanol overnight, and wash with 75% ethanol 2 times, and finally dissolved in sterile water. The genomic DNA was purified and recovered by Qiagen tip-...

Embodiment 2

[0043] Example 2 Functional Analysis of DbsATPase Gene

[0044] In this example, the function of the DbsATPase gene was analyzed by Escherichia coli transformation experiment.

[0045] 1. Construction of recombinant expression vectors

[0046] Design the following pair of primers, introduced at the 5' of the DbsATPase gene Eco RI restriction site, 3' introduced xho I restriction site.

[0047] DbsATPase-F: 5' CCGGAATTCATGGGCTATCCCATTCCCAATG3' (SEQ ID NO: 5);

[0048] DbsATPase-R: 5'CCGCTCGAGTGATCCCTGCATCAACCATTGT3' (SEQ ID NO: 6).

[0049] PCR2.1-DbsATPase vector was used as template for PCR. The PCR product and the yeast shuttle expression vector pET28a were used respectively EcoR I and xho I carried out enzyme digestion, and the enzyme digestion product was recovered, connected, and transformed into Escherichia coli DH5α. After sequencing and enzyme digestion identification, the recombinant pET28a-DbsATPase was obtained.

[0050] (1) Protein expression

[005...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a metallic cadmium resistance associated protein KdpD and a coding gene and application thereof. The amino acid sequence of the metallic cadmium resistance associated protein KdpD is shown as SEQ ID NO: 1; and the coding gene of the metallic cadmium resistance associated protein KdpD is shown as SEQ ID NO: 2. Escherichia coli transformation experiments prove that the expression of the gene in escherichia coli can improve the resistance of the gene to heavy metallic cadmium. The KdpD coding gene can be used for improving the heavy metallic cadmium resistance of microbes and plants, is further used for clearing heavy metal pollution in the environment, and provides a biological resource with excellent performance for biological repair.

Description

Technical field [0001] The invention involves the field of genetic engineering technology, which specifically involves a metal cadmium resistance -related protein KDPD and its coding genes and applications. Background technique [0002] With the development and utilization of mineral resources and industrial development, the pollution caused by heavy metals to the environment has become increasingly serious, and soil heavy metal pollution has become a issue that endangers global environmental quality.Soil heavy metals will affect the growth and development of plants, reduce the output and quality of crops, and bring serious economic losses to agricultural production.In addition, crops that are contaminated by soil heavy metal are accumulated in plants, and the food chain is rich into the human body and animals, which harms human and animal health and cause cancer and other diseases.The treatment of heavy metal pollution is urgent, and various repair technologies and measures are ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/12C12N15/54C12N15/63C12N15/70C12N1/21A62D3/02C12R1/19A62D101/43
Inventor 谢丽娟陈亮胡敏俞陆军廖斌束文圣
Owner SUN YAT SEN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More