Metallic cadmium resistance associated protein KdpD and coding gene and application thereof
A technology related to resistance and encoding genes, applied in the field of genetic engineering, can solve problems such as unclear
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Example 1 Cloning of the complete sequence of DbsATPase gene
[0026] 1. Field microbial sample collection
[0027] Acid mine wastewater (AMD) at different acidification stages (pH 2, 4, 6) was selected from the Yunfu lead / zinc mine in Guangdong, and cells in 20L AMD were collected using a 0.22 μm filter membrane. In order to maintain the integrity of the nucleic acid, save the samples and freeze them in liquid nitrogen, bring them back to the laboratory within 24 hours, and store them in a -70°C refrigerator for long-term storage.
[0028] 2. Extraction of Nucleic Acids
[0029] The EST method was used for DNA extraction, and the process was as follows: add lysozyme and proteinase K to the SET buffer, digest for 30 minutes, centrifuge at 15,000 rpm for 15 minutes, extract twice with chloroform, precipitate with isopropanol overnight, and wash with 75% ethanol 2 times, and finally dissolved in sterile water. The genomic DNA was purified and recovered by Qiagen tip-...
Embodiment 2
[0043] Example 2 Functional Analysis of DbsATPase Gene
[0044] In this example, the function of the DbsATPase gene was analyzed by Escherichia coli transformation experiment.
[0045] 1. Construction of recombinant expression vectors
[0046] Design the following pair of primers, introduced at the 5' of the DbsATPase gene Eco RI restriction site, 3' introduced xho I restriction site.
[0047] DbsATPase-F: 5' CCGGAATTCATGGGCTATCCCATTCCCAATG3' (SEQ ID NO: 5);
[0048] DbsATPase-R: 5'CCGCTCGAGTGATCCCTGCATCAACCATTGT3' (SEQ ID NO: 6).
[0049] PCR2.1-DbsATPase vector was used as template for PCR. The PCR product and the yeast shuttle expression vector pET28a were used respectively EcoR I and xho I carried out enzyme digestion, and the enzyme digestion product was recovered, connected, and transformed into Escherichia coli DH5α. After sequencing and enzyme digestion identification, the recombinant pET28a-DbsATPase was obtained.
[0050] (1) Protein expression
[005...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com