Triticum aestivum mevalonate kinase (TaMVK) gene as well as isolation colonizing and enzyme activity measuring method thereof

A technology of wheat mevalonate kinase and mevalonate kinase, applied in genetic engineering, plant genetic improvement, botany equipment and methods, etc.

Inactive Publication Date: 2012-05-02
CROP RES INST SHANDONG ACAD OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Mevalol has been isolated and cloned from Arabidopsis thaliana, rice (Oryza sativa), corn (Zea mays), sorghum (Sorghumbicolor), rubber (Hevea brasiliensis), castor (Ricinus communis) and other plants Acid kinase gene, but there is no precedent for isolating mevalonate kinase gene from wheat varieties successfully in the prior art, thus restricting the application of cloning mevalonate kinase gene in wheat production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Triticum aestivum mevalonate kinase (TaMVK) gene as well as isolation colonizing and enzyme activity measuring method thereof
  • Triticum aestivum mevalonate kinase (TaMVK) gene as well as isolation colonizing and enzyme activity measuring method thereof
  • Triticum aestivum mevalonate kinase (TaMVK) gene as well as isolation colonizing and enzyme activity measuring method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Embodiment 1 (wheat leaf RNA extracts)

[0055] (1) Wheat variety Jinan 13 was grown to the three-leaf stage in a constant temperature incubator (28° C.) with vermiculite.

[0056] (2) Grind the leaves into powder in liquid nitrogen, and transfer them to DEPC-treated EP tubes.

[0057] (3) Add appropriate amount of RNAiso Plus.

[0058] (4) Stand at room temperature for 5 minutes.

[0059] (5) Add 1 / 5 volume of RNAiso Plus in chloroform. Shake until creamy.

[0060] (6) Stand at room temperature for 5 minutes.

[0061] (7) Centrifuge at 12000g for 15 minutes at 4°C.

[0062] (8) Transfer the supernatant to a new DEPC-treated EP tube, add isopropanol equal to the volume of the supernatant, and mix well. Stand at room temperature for 10 minutes.

[0063] (9) Centrifuge at 12000g for 10 minutes at 4°C.

[0064] (10) Add 1 mL of 75% ethanol prepared with DEPC water to the precipitate. Centrifuge at 12000g for 5min at 4°C.

[0065] (11) Keep the precipitate and dry...

Embodiment 2

[0067] Example 2 (synthesis of the first strand of cDNA)

[0068] (1) Add in sequence to the DEPC-treated PCR tube:

[0069]

[0070] (2) Run on a PCR machine; 65°C for 5 minutes and then quenched on ice.

[0071] (3) Add to the PCR tube:

[0072]

[0073] (4) Carry out on PCR instrument: 42°C for 60min, 70°C for 15min

Embodiment 3

[0074] Embodiment 3 (intermediate sequence amplification)

[0075] 1 Primer design for intermediate sequences

[0076] Using Primer5.0 primer design software and DNAMAN software, primers were designed according to part of wheat mevalonate kinase EST sequence.

[0077] The upstream primer is: WmvkF: 5′GTTGGCGGAACGGAGTGGCA 3′ (Seq ID No: 3)

[0078] The downstream primer is: WmvkR: 5'CGACTTTGAAGCAGCGGAAACCAT3' (Seq ID No: 4)

[0079] The PCR system is: water 9.3 μL, 10xPCR buffer 1.5 μL, dNTP 0.7 μL, P1 0.6 μL, P2 0.6 μL, LATag 0.3 μL.

[0080] The PCR program is: 94°C for 5 min, 94°C for 45 s, 68°C for 45 s, 72°C for 90 s, 72°C for 10 min, 32 cycles.

[0081] 2 PCR result detection of intermediate sequence

[0082] Mix 8 μL of PCR amplification product with 1 μL of bromophenol blue, point it into 1.5% agarose gel, electrophoresis at 120V for 45 minutes, observe and take pictures with an ultraviolet gel imaging system, such as figure 2 Shown to check whether the target fra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of molecular biology and relates to technologies for isolation colonizing of a triticum aestivum mevalonate kinase (TaMVK) gene as a key enzyme gene which is obtained from Jinan 13 as a wheat variety and participates in isoprene-like substances such as wheat chlorophyll, carotenoid, cytokinin, abscisic acid, gibberellin, dolichol, terpenoid, coenzyme Q, sterol, phytotoxin and the like as well as prokaryotic expression of enzyme protein, separated purification of the enzyme protein and detection in vitro on the enzyme activity of the TaMVK gene. The invention provides important technical storage for further constructing a eukaryotic gene expression vector of the TaMVK gene and converting the eukaryotic gene expression vector into a corresponding crop, particularly obtaining plants with important commercial value by means of secondary metabolism, discussing the relationships between the overexpression of the TaMVK gene in a receptor plant and important economical characters such as a secondary metabolite, the seed size, the grain weight and the like, further improving the yield of the crops, analyzing the structures of an introne, an exon and a promoter of the TaMVK gene, researching the functions of the promoter and developing a relevant molecular marker.

Description

technical field [0001] The invention belongs to the field of molecular biology, and relates to a kind of wheat chlorophyll, carotenoid, cytokinin, abscisic acid, gibberellin, terpene alcohol, terpenoid, coenzyme Q, sterol obtained from wheat variety Jinan 13 Isolation and cloning of the key enzyme gene mevalonate kinase gene TaMVK synthesized with plant toxins and other isoprenoid substances, prokaryotic expression of enzyme protein, separation and purification of enzyme protein and in vitro detection technology of enzyme activity. Background technique [0002] Isoprenoid substances exist in all organisms, especially in plants, and are important organic substances necessary for maintaining plant growth and development, photosynthesis, etc. At present, more than 30,000 plant isoprenoids have been discovered, and this number is still increasing year by year. Such substances have various roles in organisms, and can be used as photosynthetic pigments (such as chlorophyll, carot...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/54C12N9/10C12N15/79C12Q1/48C12Q1/32A01H5/00
Inventor楚秀生王宝莲李玉莲樊庆琦李永波黄承彦刘爱峰高洁隋新霞
OwnerCROP RES INST SHANDONG ACAD OF AGRI SCI