Unlock instant, AI-driven research and patent intelligence for your innovation.
Triticum aestivum mevalonate kinase (TaMVK) gene as well as isolation colonizing and enzyme activity measuring method thereof
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A technology of wheat mevalonate kinase and mevalonate kinase, applied in genetic engineering, plant genetic improvement, botany equipment and methods, etc.
Inactive Publication Date: 2012-05-02
CROP RES INST SHANDONG ACAD OF AGRI SCI
View PDF0 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
Mevalol has been isolated and cloned from Arabidopsis thaliana, rice (Oryza sativa), corn (Zea mays), sorghum (Sorghumbicolor), rubber (Hevea brasiliensis), castor (Ricinus communis) and other plants Acid kinase gene, but there is no precedent for isolating mevalonate kinase gene from wheat varieties successfully in the prior art, thus restricting the application of cloning mevalonate kinase gene in wheat production
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
[0061] (7) Centrifuge at 12000g for 15 minutes at 4°C.
[0062] (8) Transfer the supernatant to a new DEPC-treated EP tube, add isopropanol equal to the volume of the supernatant, and mix well. Stand at room temperature for 10 minutes.
[0063] (9) Centrifuge at 12000g for 10 minutes at 4°C.
[0064] (10) Add 1 mL of 75% ethanol prepared with DEPC water to the precipitate. Centrifuge at 12000g for 5min at 4°C.
[0065] (11) Keep the precipitate and dry...
Embodiment 2
[0067] Example 2 (synthesis of the first strand of cDNA)
[0068] (1) Add in sequence to the DEPC-treated PCR tube:
[0069]
[0070] (2) Run on a PCR machine; 65°C for 5 minutes and then quenched on ice.
[0071] (3) Add to the PCR tube:
[0072]
[0073] (4) Carry out on PCR instrument: 42°C for 60min, 70°C for 15min
[0076] Using Primer5.0 primer design software and DNAMAN software, primers were designed according to part of wheat mevalonate kinase EST sequence.
[0077] The upstream primer is: WmvkF: 5′GTTGGCGGAACGGAGTGGCA 3′ (Seq ID No: 3)
[0078] The downstream primer is: WmvkR: 5'CGACTTTGAAGCAGCGGAAACCAT3' (Seq ID No: 4)
[0079] The PCR system is: water 9.3 μL, 10xPCR buffer 1.5 μL, dNTP 0.7 μL, P1 0.6 μL, P2 0.6 μL, LATag 0.3 μL.
[0080] The PCR program is: 94°C for 5 min, 94°C for 45 s, 68°C for 45 s, 72°C for 90 s, 72°C for 10 min, 32 cycles.
[0081] 2 PCR result detection of intermediate sequence
[0082] Mix 8 μL of PCR amplification product with 1 μL of bromophenol blue, point it into 1.5% agarose gel, electrophoresis at 120V for 45 minutes, observe and take pictures with an ultraviolet gel imaging system, such as figure 2 Shown to check whether the target fra...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
technical field [0001] The invention belongs to the field of molecular biology, and relates to a kind of wheat chlorophyll, carotenoid, cytokinin, abscisic acid, gibberellin, terpenealcohol, terpenoid, coenzyme Q, sterol obtained from wheat variety Jinan 13 Isolation and cloning of the key enzyme gene mevalonate kinase gene TaMVK synthesized with plant toxins and other isoprenoid substances, prokaryotic expression of enzyme protein, separation and purification of enzyme protein and in vitro detection technology of enzyme activity. Background technique [0002] Isoprenoid substances exist in all organisms, especially in plants, and are important organic substances necessary for maintaining plant growth and development, photosynthesis, etc. At present, more than 30,000 plant isoprenoids have been discovered, and this number is still increasing year by year. Such substances have various roles in organisms, and can be used as photosynthetic pigments (such as chlorophyll, carot...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More