Transmembrane protein gene triticum asetivum leucine rich repeat 3 (TaLRR3) with leucine rich repeat (LRR) structure domain as well as expression vector and application thereof

A technology of transmembrane protein and expression vector, applied in the field of genetic engineering, can solve the problems of lack of new resistance source, outbreak of stripe rust, economic loss and so on

Inactive Publication Date: 2012-06-20
NANJING AGRICULTURAL UNIVERSITY
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The physiological races of wheat stripe rust are highly variable. At present, the disease resistance genes in the main wheat cultivars have been gradually overcome by Tiaozhong 29, 31, 32 and the newly mutated physiological races, and there is still a lack of new sources of resistance. , once the conditions are right, stripe rust may break out again, causing heavy economic losses

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transmembrane protein gene triticum asetivum leucine rich repeat 3 (TaLRR3) with leucine rich repeat (LRR) structure domain as well as expression vector and application thereof
  • Transmembrane protein gene triticum asetivum leucine rich repeat 3 (TaLRR3) with leucine rich repeat (LRR) structure domain as well as expression vector and application thereof
  • Transmembrane protein gene triticum asetivum leucine rich repeat 3 (TaLRR3) with leucine rich repeat (LRR) structure domain as well as expression vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1 Cloning of the transmembrane protein gene Ta-LRR with LRR domain induced by stripe rust in 92R137

[0026] 92R137 is a translocation line created by Nanjing Agricultural University by crossing tetraploid Triticum turgitum with diploid Triticum villosa (Haynaldia villosa) and backcrossing with hexaploid common wheat several times. (Chen, P.D., Qi, L.L., Zhou, B., S.Z. Zhang, D.J. Liu. 1995 Development and molecular cytogenetic analysis of wheat-Haynaldia villosa 6VS / 6AL translocation lines specifying resistance to powdery mildew. TAG, (91): 1125-1128 .). Chromosome 1B of 92R137 contains the wheat stripe rust resistance gene Yr26, which has a high level of resistance to dominant races such as 29, 31, and 32 in the highly virulent race (Chunmei Wang, Yiping Zhang, Dejun Han, Zhensheng Kang, Guiping Li, Aizhong Cao, Peidu Chen. SSR and STS markers for wheat stripe rust resistance gene Yr26. Euphytica, 2008, 159: 359-366.).

[0027] In order to clone the resistan...

Embodiment 2

[0029] The expression characteristics of embodiment 2 TaLRR3 gene being induced by stripe rust

[0030] In order to study the expression pattern of TaLRR3 in stripe rust resistant materials, the RNA reverse transcription cDNA of the resistant material 92R137 and the susceptible material Yangmai 158 induced by stripe rust for 0, 6, 12, 24, and 72 hours were used as templates. Real-time fluorescence quantitative PCR (Q-PCR) analysis was performed using P1 and P2 as primers. The PCR program is as follows: the PCR reaction is amplified on a real-time fluorescent quantitative PCR instrument (MyIQ, Bio-Rad Company, USA) and the fluorescence is detected. The 20uL PCR reaction system contains 10uL of 2×SYBR Green PCR Master Mix, 0.5μM primers P1 and P2, 2uL of reverse transcription cDNA template, and supplemented with water to 20uL. The amplification parameters were: 95°C for 10 minutes, then 95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 1 minute, a total of 40 cycles. Afte...

Embodiment 3

[0031] Example 3 Construction of TaLRR3 overexpression vector and its transformation into common wheat Yangmai 158 and identification of resistance to stripe rust

[0032] Using the cDNA from 92R137 as a template, primers P3 (CGCGGATCCATGGCTGATGATACCAAG, SEQ ID NO.5) and P4 (CGAGCTCTCATATCCGGACGACGTA, SEQ ID NO.6) across the ORF were designed with the full-length sequence of the TaLRR3 gene obtained by the RACE method, and P3 With BamHI restriction site, P4 with SacI restriction site. PCR amplification was performed using primer pairs P3 and P4, and amplified fragments were recovered. The amplified product was double digested with BamHI and SacI, and the digested product was inserted into the vector pBI220 (Jefferson RA, Kavanagh TA, Bevan MW. GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J.1987, 6:3901-3907.), put TaLRR3 at the multiple cloning site behind the 35S promoter, and replace the GUS gene carried by the vecto...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a transmembrane protein gene triticum asetivum leucine rich repeat 3 (TaLRR3) with a leucine rich repeat (LRR) structure domain as well as an expression vector and an application thereof and belongs to the field of gene engineering. The complementary deoxyribonucleic acid (cDNA) sequence of the transmembrane protein gene TaLRR3 with the LRR structure domain is SEQ ID NO.1,and the coded amino acid sequence is SEQ ID NO.2. The gene is from ordinary wheat (Triticum asetivum L.) 92R137 and is reported in the wheat for the first time. The TaLRR3 is induced by stripe rust in a stripe rust resistant wheat variety 92R137, the expression is enhanced, and in addition, the expression level is much higher than the expression level in the disease susceptible variety Yangmai 158. The gene is inserted into pBI220 to obtain an over-expression vector, in addition, the susceptible stripe rust wheat variety Yangmai 158 is converted, and T0-generation stripe rust qualification results show that the over-expression of the TaLRR3 can improve the stripe rust resistance of the susceptible stripe rust wheat variety.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and discloses a transmembrane protein gene TaLRR3 with an LRR domain, an expression vector and application thereof. Background technique [0002] The whole growth period of wheat (Triticum aestivum) is harmed by various diseases and insect pests. Among them, the stripe rust caused by the infection of wheat stripe rust (Puccinia striiformis f.sp.tritic) mainly occurs on leaves, followed by leaf sheaths and stems. , spike glume and awn can also occur. Stripe rust is one of the most important diseases threatening my country's Northwest, Southwest, Huanghuai winter wheat regions and Northwest spring wheat regions, especially in cool regions with high latitude or high altitude. The disease often causes a severe reduction in wheat production, such as a 10-20% yield reduction in a moderately endemic year, a 30% yield reduction in a major epidemic year, and a 50-60% yield reduction in a particularly s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C12N15/63C07K14/415A01H5/00
Inventor曹爱忠蒋正宁葛帅邢莉萍王秀娥徐磊韩德俊王晓杰康振生陈佩度
OwnerNANJING AGRICULTURAL UNIVERSITY