Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for preparing cecropins AD and frog Buforin II fusion antimicrobial peptide by using hydroxylamine cutting method, and uses thereof

A technology of hydroxylamine cutting and cecropin, applied in the field of bioengineering, can solve the problems of affecting the activity of antibacterial peptides, low expression efficiency, long growth cycle of yeast, etc., and achieve the effects of reducing production cost and simplifying purification process.

Inactive Publication Date: 2012-07-04
BIOTECH CENT OF SHANDONG ACAD OF SCI
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The yeast expression system has the potential to directly secrete and express antimicrobial peptides, but the growth cycle of yeast is long, and antimicrobial peptides containing more basic amino acids are easily degraded, and the expression efficiency is not high; the expression system also has N-terminal signal peptide cleavage Incomplete, directly affecting the activity of antimicrobial peptides; at the same time, there are potential problems of modification of expressed antimicrobial peptides, such as glycosylation, methylation, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing cecropins AD and frog Buforin II fusion antimicrobial peptide by using hydroxylamine cutting method, and uses thereof
  • Method for preparing cecropins AD and frog Buforin II fusion antimicrobial peptide by using hydroxylamine cutting method, and uses thereof
  • Method for preparing cecropins AD and frog Buforin II fusion antimicrobial peptide by using hydroxylamine cutting method, and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Synthesis of cecropin AD and frog Buforin II fusion gene CAD-Buforin II

[0038] 1 Synthesize the fusion gene of Cecropin AD and Frog Buforin II, design 4 pairs of primers:

[0039] F1

[0040] GGATCC AAATGGAAACTGTTCAAAAAAATCGAAAAAGTTGGTCAGCGTGTTCGT

[0041] R1

[0042] AGCAGAGATAACAGCGTCACGAACACGCTGACCAACTTTTTCGA

[0043] F2

[0044] GACGCTGTTATCTCTGCTGGTCCGGGTGTTGCTACCTTCG

[0045] R2

[0046] TTAGCCAGAGCGGTAGCCTGAGCGAAGGTAGCAACACCCGGACC

[0047] F3

[0048] CTCAGGCTACCGCTCTGGCTAAA ACCCGTTCTTCTCGTGCT

[0049] R3

[0050] ACCAACCGGGAACTGCAGACCAGCACGAGAAGAACGGGT T

[0051] F4

[0052] GGTCTGCAGTTCCCGGTTGGTCGTGTTCACCGTCTGCTGCGTAAAGAATTC

[0053] R4

[0054] GAATTC TTTACGCAGCAGACGGTGAACACG

[0055] The fusion gene CAD-Buforin II gene of Cecropin AD and Frog Buforin II was synthesized by 3 rounds of PCR. The 5'end and 3'end of the fusion gene were added with BamH I and EcoR I restriction enzyme sites (underlined Out), a hydroxylamine cleavage site (in bold) is added to the 5'end...

Embodiment 2

[0064] Example 2 Construction of CAD-Buforin II gene cloning and expression recombinant plasmid

[0065] 2.1 The construction of CAD-Buforin II gene recombinant plasmid:

[0066] The plasmid pET-Trx was extracted and digested with BamH I and EcoR I to recover a 3.3 kb linear plasmid;

[0067] The artificially synthesized CAD-Buforin II gene fragment in step 1 was digested with BamH I and EcoR I, and an equal volume of phenol: chloroform: isoamyl alcohol (volume ratio 25: 24:1) was added to extract, 3 times the volume Absolute ethanol precipitation to recover the digested fragments;

[0068] The fragments of the digested product recovered above were ligated with T4DNA ligase, and the ligation reaction system was 25μl:

[0069]

[0070] The ligation was carried out overnight at 16°C, and the ligation product was the pET-Trx-CAD-Buforin II recombinant plasmid.

[0071] 2.2 The recombinant plasmid pET-Trx-CAD-Buforin II was transformed into E. coli Top 10 to verify the recombination results...

Embodiment 3

[0073] Example 3 Construction and screening of engineering strains expressing CAD-Buforin II

[0074] 3.1 The recombinant plasmid pET-Trx-CAD-Buforin II transforms the expression strain BL21

[0075] Take 1μl of the pET-Trx-CAD-Buforin II plasmid constructed in 2.1 above, dilute 10 times and directly transform E.coli expression strain BL21(DE3)plysS competent cells, spread LB+Amp plate, and invert overnight at 37℃.

[0076] 3.2 Screening of engineered strains expressing CAD-Buforin II

[0077] Pick 4 monoclonal colonies from the above-mentioned LB plate, culture in 2ml LB+Amp liquid medium with shaking at 37℃ overnight, and add 20μl of overnight culture to 2ml YTA+Amp liquid medium for transfer culture, shaking culture at 37℃ 3h, until the OD600 is between 0.5 and 0.7, then add IPTG to a final concentration of 0.3mM, culture with shaking at 30℃ to induce expression for 3-8h. Before induction, 0.5ml of bacterial solution was randomly taken from a sample and used as induction control d...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a process method for fusion expression of antimicrobial peptides (CAD and Buforin II) with two different bactericidal mechanisms and forming two antimicrobial peptide composite preparations by using hydroxylamine cutting. Hydroxylamine can be used to specifically cut an Asn-Gly peptide bond in protein, an Asn-Gly site is introduced in a connecting part of a fusion protein and an additional sequence (His tag), and the fusion protein is efficiently expressed by an escherichia coli expression system; and after affinity chromatography purification, a recombined CAD-Buforin II is obtained; and the recombined CAD-Buforin II is cut by hydroxylamine again, and is continuously separated and purified to obtain the purified CAD and Buforin II composite antimicrobial peptides. The fusion protein provided by the invention can be used as an animal feed additive part to replace the traditional antibiotic additive.

Description

Technical field [0001] The invention belongs to the field of bioengineering. Specifically, it relates to a preparation method of compound antibacterial peptide Cecropin AD and frog Buforin II. Background technique [0002] Antimicrobial peptides can inhibit and kill bacteria by interfering and blocking many metabolic pathways of bacteria, exerting an intracellular killing effect. Antibacterial peptides of different types and structures can attack different intracellular targets to exert their antibacterial effects. Certain types of antibacterial peptides can also have both membrane attack and intracellular killing effects, and there are multiple targets. Due to the diversification of antimicrobial peptide mechanisms and targets, it is difficult for bacteria to develop drug resistance through mutation. In addition, certain antimicrobial peptides have a synergistic effect when used in combination with traditional antimicrobial drugs. Therefore, antimicrobial peptides are expecte...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/70C12N1/21C07K14/435C07K14/46C07K1/12A61K38/17A61P31/04A23K1/16C12R1/19
Inventor 扈进冬郑凯杨合同李纪顺魏艳丽周红姿李红梅
Owner BIOTECH CENT OF SHANDONG ACAD OF SCI