OYE 3 gene deriving from saccharomyces cerevisiae and preparation method and application thereof
A Saccharomyces cerevisiae and gene technology, applied in the field of crop genetics and breeding, can solve problems such as hindering the self-purification process of water bodies
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1: Synthesis of Saccharomyces cerevisiae OYE3 gene by gene synthesis
[0025] According to the plant preference code, the gene encoding Saccharomyces cerevisiae OYE3 was re-synthesized, and the synthetic primers of the OYE3 gene were as follows:
[0026] OYE3-1:
[0027] GAA, ATGCCATTTGTAAAAGGTTTTGAGCCGATCTCCCTAAGAGACACAAACCTT
[0028] OYE3-2:
[0029] GATGTGCAAGCTGAGTGTTACCAATCTTAATTGGTTCAAAAAAGGTTTGTGTCTCTTAGGG
[0030] OYE3-3:
[0031] TAACACTCAGCTTGCACATCGTGCGGTTATGCCCCCATTGACCAGAATGAGGGCCACTCA
[0032] OYE3-4:
[0033] ATACACACAGCAGCCCACTCCTTATTTGGAATATTTCCGGGGTGAGTGGCCCTCATTCTGGT
[0034] OYE3-5:
[0035] AGGAGTGGGCTGCTGTGTATTATGGTCAGCGTGCTCAAAGACCTGGTACCATGATCATCA
[0036] OYE3-6:
[0037] TCATAGCCGCCGGCTTGAGGGGAAATAAACGTACCTTCCGTGATGATCATGGTACCAGGT
[0038] OYE3-7:
[0039] CCTCAAGCCGGCGGCTATGACAACGCCCCTGGGATTTGGTCTGATGAGCAGGTCGCTGAG
[0040] OYE3-8:
[0041] ACGACTGACAATCATGGATGGCTAAAAAGATATTCTTCCACTCAGCGACCTGCTCATCAG
[0042] OYE3-9:
[...
Embodiment 2
[0090] Embodiment 2: Saccharomyces cerevisiae OYE3 enzyme gene expression vector construction
[0091] Respectively use BamHI and SacI to double-enzyme digest the PCR products, recover the DNA fragments with 1% agarose gel, connect the recovered OYE3 enzyme gene fragments to the pYPx245 plasmid containing double 35S promoters by T4DNA ligase, enzyme digestion identification and sequence analysis The recombinant plasmid AH128 containing Saccharomyces cerevisiae OYE3 enzyme gene was determined. The expression vector also contains a GUS reporter gene and a kanamycin resistance marker gene with an intron, the vector such as figure 1 shown.
Embodiment 3
[0092] Embodiment 3: Agrobacterium cultivation
[0093] The recombinant plasmid was introduced into Agrobacterium by electric shock method. Pick Agrobacterium tumefaciens LBA4404 single bacterium to 25mL YEB medium (50mg / L rifampicin) for overnight culture, take 5mL bacterial liquid transfer to 100mL YEB medium (50mg / L rifampicin), cultivate to OD600=0.7 -0.8, place the bacterial solution on ice for 10 minutes, centrifuge at 5000 rpm for 10 minutes, and collect the bacterial cells at 4°C, add 100 mL of sterile double distilled water to wash twice. Add 4mL of 10% glycerol to suspend the bacteria and transfer to a 50ml centrifuge tube. Centrifuge at 5500rpm for 10min at 4°C. Collect the bacteria, add 500 μL of 10% glycerol to suspend the bacteria, and transfer to a 1.5ml centrifuge tube. Take 70 μL of the Agrobacterium competent cells prepared above, add 1 μL of the recombinant plasmid AH128, mix well with a yellow pipette tip with the head removed, and transfer to a 0.1 cm e...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 