Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Powdery mildew resistance-related protein TaWRKY1 and coding gene thereof

A technology that encodes genes and powdery mildew, applied in genetic engineering, plant genetic improvement, viruses/bacteriophages, etc., can solve problems such as rapid mutation and loss of effective disease-resistant genes.

Inactive Publication Date: 2012-08-29
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Because wheat powdery mildew has a large population, a wide range of adaptation, many physiological races, and a fast mutation rate, many effective disease-resistant genes lose resistance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Powdery mildew resistance-related protein TaWRKY1 and coding gene thereof
  • Powdery mildew resistance-related protein TaWRKY1 and coding gene thereof
  • Powdery mildew resistance-related protein TaWRKY1 and coding gene thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Embodiment 1, the acquisition of TaWRKY1

[0025] 1. Candidate EST and electronic extension of gene full-length cDNA

[0026] Using barley HvWRKY1 as the seed sequence, search the wheat EST database ( http: / / compbio.dfci.harvard.edu / tgi / cgi-bin / tgi ) in the EST sequence, save highly homologous EST sequences, assemble the searched sequences into contigs (contig), and design specific primers outside the predicted open reading frame (Openreading frame, ORF); primer sequence as follows:

[0027] TaWRKY1: F1 5'>ATGGATCCATGGGTCAGCAG>3' (SEQ ID NO: 3)

[0028] R1 5'>TTAATTGATGTCCCTGGTC>3' (SEQ ID NO: 4)

[0029] 2. Cloning of cDNA of wheat TaWRKY1 gene

[0030] Select 40 seeds each of Yumai 66 (high resistance to powdery mildew) and Jing 411 (high susceptibility to powdery mildew) of the same size, and sow them in seedling pots until the first leaf is fully unfolded (about a week). Wheat materials were inoculated at high density with wheat powdery mildew race 15 (strain ...

Embodiment 2

[0032] Example 2, Molecular properties and mechanism of action of wheat TaWRKY1

[0033] One of the characteristics of transcription factors is that they localize in the nucleus and perform their transcriptional regulatory functions in the nucleus. To this end, the subcellular localization of wheat TaWRKY1 protein was studied in wheat leaf cells by gene gun-mediated method. The results showed that, like barley HvWRKY2, wheat TaWRKY1 was also localized in the nucleus ( figure 1 ). figure 1 Among them, CFP (cyan fluorescent protein), CFP-HvWRKY2 (CFP is at the N-terminus of HvWRKY2), TaWRKY1-YFP (yellow fluorescent protein is at the C-terminus of TaWRKY1), Overlay overlaps.

Embodiment 3

[0034] Example 3, Functional Research of TaWRKY1 in Barley and Wheat Resistance to Powdery Mildew

[0035] 1. The function of TaWRKY1 in resistance to powdery mildew in barley

[0036] (1) Effect of TaWRKY1 on race-specific resistance in barley

[0037] The vector pGY-1 has been disclosed in the document "Patrick Schweizer et al, A Transient Assay System for the Functional Assessment of Defense-Related Genes in Wheat. MPMI, 1999, 12: 647-654", and the public can obtain it from Genetics and Developmental Biology of the Chinese Academy of Sciences obtained from the Institute of Science.

[0038] The vector p35S-GUS has been disclosed in the document "Patrick Schweizer et al, A Transient Assay System for the Functional Assessment of Defense-Related Genes in Wheat. MPMI, 1999, 12: 647-654", and the public can download it from the Chinese Academy of Sciences Genetics and Developmental Biology obtained from the Institute of Science.

[0039] Barley variety P01 (including Mla1) ha...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses powdery mildew resistance-related protein TaWRKY1 and a coding gene thereof. The protein is protein which is shown by (a) or (b): (a) protein consisting of an amino acid sequence shown by SEQ ID NO: 1; and (b) protein derived from (a) by substituting and / or deleting and / or adding one or more amino acid residues based on the amino acid sequence shown by the SEQ ID NO: 1 and related to powdery mildew resistance. Experiments prove that the gene is used for negative regulation of the powdery mildew resistance performance of wheat or barley. The gene has broad application prospect in the aspect of wheat breeding and great significance in the aspect of guaranteeing high and stable yield of wheat.

Description

technical field [0001] The invention relates to a protein TaWRKY1 related to powdery mildew resistance and its coding gene. Background technique [0002] Wheat powdery mildew (Powdery mildew) is a fungal disease caused by the obligate parasitic fungus Powdery mildew Bgt (Blumeria graminis f sp. tritici). It is a worldwide distribution disease and seriously affects the world's wheat production. In recent years, due to the increase of crop planting density, the increase of nitrogen fertilizer application, and the single planting of crops, the damage caused by wheat powdery mildew has become increasingly serious. After the wheat is damaged, it can lead to early withering of leaves, reduced photosynthesis, enhanced respiration, reduced number of tillers, reduced ear formation rate, and reduced dry grain weight. Generally, the yield can be reduced by 5% to 10%, and the yield of severely diseased fields can be reduced by more than 20%. Because wheat powdery mildew has a large pop...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/11C12N15/63C12N1/15C12N1/19C12N1/21C12N5/10C12N7/01A01H5/00
Inventor 沈前华韩新运王秋韫刘敏
Owner INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com