Powdery mildew resistance-related protein TaWRKY1 and coding gene thereof
A technology that encodes genes and powdery mildew, applied in genetic engineering, plant genetic improvement, viruses/bacteriophages, etc., can solve problems such as rapid mutation and loss of effective disease-resistant genes.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Embodiment 1, the acquisition of TaWRKY1
[0025] 1. Candidate EST and electronic extension of gene full-length cDNA
[0026] Using barley HvWRKY1 as the seed sequence, search the wheat EST database ( http: / / compbio.dfci.harvard.edu / tgi / cgi-bin / tgi ) in the EST sequence, save highly homologous EST sequences, assemble the searched sequences into contigs (contig), and design specific primers outside the predicted open reading frame (Openreading frame, ORF); primer sequence as follows:
[0027] TaWRKY1: F1 5'>ATGGATCCATGGGTCAGCAG>3' (SEQ ID NO: 3)
[0028] R1 5'>TTAATTGATGTCCCTGGTC>3' (SEQ ID NO: 4)
[0029] 2. Cloning of cDNA of wheat TaWRKY1 gene
[0030] Select 40 seeds each of Yumai 66 (high resistance to powdery mildew) and Jing 411 (high susceptibility to powdery mildew) of the same size, and sow them in seedling pots until the first leaf is fully unfolded (about a week). Wheat materials were inoculated at high density with wheat powdery mildew race 15 (strain ...
Embodiment 2
[0032] Example 2, Molecular properties and mechanism of action of wheat TaWRKY1
[0033] One of the characteristics of transcription factors is that they localize in the nucleus and perform their transcriptional regulatory functions in the nucleus. To this end, the subcellular localization of wheat TaWRKY1 protein was studied in wheat leaf cells by gene gun-mediated method. The results showed that, like barley HvWRKY2, wheat TaWRKY1 was also localized in the nucleus ( figure 1 ). figure 1 Among them, CFP (cyan fluorescent protein), CFP-HvWRKY2 (CFP is at the N-terminus of HvWRKY2), TaWRKY1-YFP (yellow fluorescent protein is at the C-terminus of TaWRKY1), Overlay overlaps.
Embodiment 3
[0034] Example 3, Functional Research of TaWRKY1 in Barley and Wheat Resistance to Powdery Mildew
[0035] 1. The function of TaWRKY1 in resistance to powdery mildew in barley
[0036] (1) Effect of TaWRKY1 on race-specific resistance in barley
[0037] The vector pGY-1 has been disclosed in the document "Patrick Schweizer et al, A Transient Assay System for the Functional Assessment of Defense-Related Genes in Wheat. MPMI, 1999, 12: 647-654", and the public can obtain it from Genetics and Developmental Biology of the Chinese Academy of Sciences obtained from the Institute of Science.
[0038] The vector p35S-GUS has been disclosed in the document "Patrick Schweizer et al, A Transient Assay System for the Functional Assessment of Defense-Related Genes in Wheat. MPMI, 1999, 12: 647-654", and the public can download it from the Chinese Academy of Sciences Genetics and Developmental Biology obtained from the Institute of Science.
[0039] Barley variety P01 (including Mla1) ha...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com