Supercharge Your Innovation With Domain-Expert AI Agents!

Yunnan red pear [delta]PybHLH gene and prokaryotic expression vector and application thereof

A prokaryotic expression and gene technology, applied in the field of genetic engineering, can solve problems such as lack of scientific theory, and achieve the effect of strong specificity, efficient purification and high specificity

Inactive Publication Date: 2012-09-12
KUNMING UNIV OF SCI & TECH
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But, the scientific theory deficiency of the red pear coloring of instruction breeding, achievement of the present invention will lay the foundation for the molecular breeding of fruit trees and flowers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Yunnan red pear [delta]PybHLH gene and prokaryotic expression vector and application thereof
  • Yunnan red pear [delta]PybHLH gene and prokaryotic expression vector and application thereof
  • Yunnan red pear [delta]PybHLH gene and prokaryotic expression vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Embodiment 1: the present invention PyBH Genes and their specific fragments ?PybHLH cloning, the specific steps are as follows:

[0040] (1) Primer design

[0041] according to apple MdbHLH33 Gene (GenBank accession number is DQ266451.1) coding frame, design a pair of specific primers PybHLH-F : 5'- GTC GAC ATGGCTCAGAATCATGAGAGGGTG-3' and PybHLH-R :3': CTCGAG GCACTTACCAGCAATTTTCCAAAGC, added at the 5′ end of the upstream and downstream primers respectively Sal I and xho I Restriction site and protective base (the underlined part is the restriction site).

[0042] (2) Extraction of total RNA

[0043] a. After fully grinding the red pericarp of 0.1 g Yunhong pear into powder with liquid nitrogen, add 1 ml RNA extraction buffer (4 M guanidine isothiocyanate, 25 mM sodium citrate, 0.5 % (w / v) 12 Alkyl sarcosinate, 2% (w / v) PVP, β-mercaptoethanol), transferred to a 2 ml centrifuge tube, grinded evenly, and then added 1 / 10 volume of 2 M sodium acetate (pH 4....

Embodiment 2

[0056] Example 2: Prokaryotic expression vector pET32a- ?PybHLH build ( Figure 11 )

[0057] use Nco I and xho I to pMD18T- ?PybHLH and the vector pET32a were digested according to the instructions to obtain the 5' end carrying Nco I and 3' end with xho I's ?PybHLH The fragment and the pET32a vector were gel-recovered after electrophoresis, and the sample was loaded according to the molar ratio of target gene:vector = 3:1, then Ligation Solution I was added, and ligated at 16°C for 16 h. Competent Escherichia coli E. coli DH5α 100 μl was added to 6 μl connection system and mixed; the mixture was ice-bathed for 30 min, heat stimulated at 42 °C for 45 s, and ice-bathed for 2 min; 900 μl liquid medium SOC was added, and the bacteria were recovered by shaking at 37 °C at 200 rpm for 60 min; After the end, centrifuge at 8000 rpm at room temperature for 1 min to collect the bacteria; absorb the supernatant on the ultra-clean bench, and when about 0.1 ml remains, use a pi...

Embodiment 3

[0058] Example 3: ?PybHLH Prokaryotic expression of

[0059] The recombinant plasmid pET32a- ΔPybHLH Transformed into E. coli Rosetta (DE3) Competent cells. Apply LB+Amp solid plate, pick pET32a-Δ PyBH The recombinant colonies were cultured in LB + Amp liquid medium at 37 °C and 200 rpm shaking overnight, and then inoculated on the same LB medium at a ratio of 1:100 and cultivated to OD 600 0.6-0.8, add IPTG to a final concentration of 0.5 mM, culture at 16 °C for 0, 2, 4, 6 and 16 h, and collect the bacterial liquid for total protein analysis. Centrifuge at 12 000 rpm at 4°C for 1 min, discard the supernatant, and use 100 μl of SDS gel loading buffer (Tris-HCl 50 mM, pH 6.8; SDS 2 %; DTT 100 mM; bromophenol blue 0.1 %; Glycerol 10%) was resuspended, boiled for 5 min, centrifuged at 12 000 rpm for 1 min, and 20 μl of the supernatant was taken for SDS-PAGE detection. Stain with Coomassie brilliant blue R-250 staining solution (0.1% Coomassie brilliant blue R-250, 40% m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a biological synthesis of a Yunnan red pear anthocyanidin and a specific segment [delta]PybHLH of a trichome generating developmental regulation protein PybHLH gene and a prokaryotic expression vector thereof. By cloning the specific fragment [delta]PybHLH from Yunnan red pears through RT-PCR technology, and constructing a prokaryotic expression vector thereof and expressing in escherichia coli, a Yunnan red pear [delta]PybHLH purified protein is obtained. The Yunnan red pear [delta]PybHLH purified protein is applied to the preparation of a PybHLH specific antibody which can be used for a PybHLH expression detection, immunoprecipitation and chromatin immunization coprecipitation. The antibody has a strong specificity, can accurately detect subcellular positioning of the PybHLH protein, efficiently conduct the purification of the PybHLH protein, separate proteins and DNA fragments combined by the PybHLH protein and detect expressing condition thereof in transgenic plants.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and specifically relates to a specific fragment of a Yunnan red pear anthocyanin biosynthesis and trichome development regulation protein gene ?PybHLH Its prokaryotic expression vector, and the application of the prokaryotic expression vector in the preparation of ?PybHLH protein and specific antibody. technical background [0002] Red peel is an important trait index in pear molecular breeding. Due to its unique geographical and climatic conditions, Yunnan Province has more germplasm resources of red skin pears. Since 1986, four cultivars, Zaobaimi, Meirensu, Mantianhong and Yunhongli No. 1, have been bred successively. However, except for Yunhongli No. 1, the other three varieties will have poor coloration or even no coloration due to climate change. Therefore, it is necessary to study the coloration mechanism of red pear peel. Previous studies have shown that the synthesis of plant anthocy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/70C07K14/415C07K16/16
Inventor 李昆志张晓东崔道雷樊磊陈丽梅舒群苏俊
Owner KUNMING UNIV OF SCI & TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More