Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Catalytic composite and visual detection method

A complex, catalytic zone technology, applied in biochemical equipment and methods, biological testing, microbial determination/inspection, etc., to achieve the effects of simple conditions, high sensitivity, high specificity and sensitivity

Inactive Publication Date: 2012-09-19
THE NAT CENT FOR NANOSCI & TECH NCNST OF CHINA
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The present invention aims at the problem that the sensitivity of the current visual detection method needs to be improved, the phenomenon based on color change is not suitable for all experimenters, and the complicated experimental means and methods still need to be improved.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Catalytic composite and visual detection method
  • Catalytic composite and visual detection method
  • Catalytic composite and visual detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Example 1 Platinum nanoparticles modify DNA via oligonucleotide linkers

[0061] Proceed as follows:

[0062] 1. 100nm platinum-shell gold core nanoparticles synthesized with a mass fraction of 1ppm (synthesized according to the method in the following patent literature: a method for preparing bimetallic nanorods with a dendritic gold core / platinum shell structure, application number: 200710178616) Mix with thiol-containing oligonucleotide sodium phosphate (sequence 1: TCGGTACACG) buffer (0.01M PBS), the mixing volume ratio of the two is 50:1, and co-incubate at room temperature for 12 hours. Prepare oligonucleotide adapters containing platinum nanoparticles.

[0063] 2. Ultrasonic fragmentation of the DNA long chain of Staphylococcus aureus specimen, and respectively add the following liquids in a 500 microliter centrifuge tube: configure 2 microliters of 10pM DNA fragment 0.01M TE buffer, 0.1M alkaline phosphate buffer ( sigma product) 5 microliters, calf small in...

Embodiment 2

[0066] Example 2 Platinum nanoparticles modify DNA by PCR

[0067] Proceed as follows:

[0068] 1. The platinum nanoparticles with a mass fraction of 1ppm are mixed with the phosphate buffer solution (0.01M PBS) of PCR primers 1 and 2 specific to the Shigella dysenteriae DNA to be tested. 12 hours. PCR primer 1 (sequence 2: CTCAGTGCCTCTGCGGAGCTTCG) and primer 2 (sequence 3: GAGAGTTCTGACTTTTATCCCG) specific to the DNA to be detected were prepared to contain platinum nanoparticles. (Purchased from Baobio Bioengineering Dalian Co., Ltd.)

[0069] 2. Carry out the reaction in the small tube of the reaction (reaction volume is 100 microliters): Tag DNA polymerase (5U / μl) 0.5μl, 0.1M Tag enzyme buffer 10μl, MgCl2 (25mM) 8μl, dNTP (each 2.5mM) 8 μl, 1 μg of sample DNA, 2 μl each of platinum nanoparticle-labeled primers-1 and -2 (20 μM), and sterilized water to 100 μl.

[0070] 3. Put it in the preheated PCR machine, 95°C for 30 seconds, 50°C for 30 seconds, and 72°C for 50 seco...

Embodiment 3

[0071] Example 3 Platinum nanoparticles directly modify RNA

[0072] Proceed as follows:

[0073] 1. Platinum nanoparticles with a mass fraction of 1ppm and 1mM synthetic (purchased from Treasure Bioengineering Dalian Co., Ltd.) 5' end containing HS-(CH 2 ) 6 - The RNA sequence (sequence 4: CTCAGTGCCTCTGCGGAGCTTCG) (designed according to Shigella dysenteriae DNA) was mixed with buffer (0.01M PBS), the mixing volume ratio of the two was 1:1, and incubated at room temperature for 12 hours.

[0074] 2. After centrifugation at 14,000 rpm in a 1.5ml centrifuge tube, the platinum nanoparticle-modified RNA was obtained in the form of precipitation, and 0.01M PBS was used to resuspend to obtain the platinum nanoparticle-containing RNA.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to a visual detection method. Visual detection is performed by converting indicating substances of traditional target molecules into catalysts such as nano-particles or enzymes capable of achieving catalysis for gas generation, and then using the catalysts at the positions of the target molecules to catalyze substrates to generate gas. By the aid of the method, detection sensitivity can be greatly improved, and even single molecule detection can be achieved. Generated bubbles are regarded as visual signals to be read, and accordingly the method is high in speed, easy to detect and extremely high in sensitivity and facilitates reading of results, and equipment for analysis is greatly simplified. The technology high in throughput and sensitivity and capable of achieving real-time detection can be obtained. The method high in adaptability is applicable to clinical and common laboratories and even can be used for field detection.

Description

technical field [0001] The invention relates to a catalytic complex of biomolecules and a visual detection method. Background technique [0002] Sensitive biological detection methods have always been a research hotspot in different fields. From the prevention and treatment of infectious diseases, genetic diseases, cancer and common diseases, to environmental pollution, health and hygiene and other fields, researchers are still moving towards more sensitive, simpler and easier methods. Detection direction efforts. Among them, visual signal reading is an attractive field, such as pregnancy test strips, which have become the most widely used means of pregnancy self-test due to their simplicity, based on the principle that the presence of target molecules will cause gold nano Aggregation of particles, resulting in a change in color. At present, detection methods based on similar principles have been widely used in many fields. For example, in recent years, the color change ge...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/527C12Q1/30G01N33/68G01N33/53
Inventor 宋炉胜朱劲松
Owner THE NAT CENT FOR NANOSCI & TECH NCNST OF CHINA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com