Recombined dimerization antithrombin III-Fc fusion protein and mammalian cell efficient expression system thereof

A fusion protein, hat-l-vfc technology, applied in cells modified by introducing foreign genetic material, drug combinations, extracellular fluid diseases, etc., can solve the problem of low expression, prolonged half-life AT derivatives, short half-life question

Active Publication Date: 2012-09-26
AMPSOURCE BIOPHARMA (SHANGHAI) INC
View PDF16 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0014] In view of the shortcomings and limitations of the preparation of AT described in the above prior art and its clinical application, such as low expression, short half-life and poor stability, there is an urgent need in this field to develop a long-acting, stable and AT derivatives that reduce production costs
So far, there is no AT derivative AT with a significantly prolonged half-life and high-efficiency and stable expression.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombined dimerization antithrombin III-Fc fusion protein and mammalian cell efficient expression system thereof
  • Recombined dimerization antithrombin III-Fc fusion protein and mammalian cell efficient expression system thereof
  • Recombined dimerization antithrombin III-Fc fusion protein and mammalian cell efficient expression system thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0085] Example 1. Construction of a gene encoding hAT-L-vFcγ fusion protein

[0086] The human AT gene was purchased from Thermo-Fisher. The target gene was amplified by polymerase chain reaction (PCR). To facilitate cloning, the oligonucleotide sequence TCAGATCGCTAGCCGCCCACCATGGTCTCCCAGGCCCTCAGGCTC was introduced into the restriction enzyme endonucleation site NheI as the 5'primer; the BamHI restriction endonuclease endonuclease site will be introduced The dotted oligonucleotide sequence GTCGAGGATCCGGGAAATGGGGCTCGCAGGAGGAC was used as the 3'primer. The human AT gene sequence was verified by DNA sequencing.

[0087] Flexible peptide Linker and human IgG Fc region Fc γ2 Variant vFc γ2 (Pro331Ser mutation), Fc γ4 Variant vFc γ4 (Ser228Pro and Leu235Ala mutation), Fc γ1 Variant vFc γ1 The fusion genes (Leu234Val, Leu235Ala and Pro331SSer mutations) were obtained by artificial synthesis. The 5'and 3'ends of the synthesized fragments each have a restriction enzyme endonucleation ...

Embodiment 2

[0089] Example 2. Expression of fusion protein in transfected cell line

[0090] Transfect the recombinant expression vector plasmid into a mammalian host cell line to express hAT-L-vFc γ Fusion protein. In order to stabilize high-level expression, the preferred host cell line is DHFR enzyme-deficient CHO-cells (US Patent No. 4,818,679). A preferred method of transfection is electroporation, but other methods can also be used, including calcium phosphate co-precipitation, lipofection, and protoplast fusion. In electroporation, use Gene Pulser Electroporator (Bio-Rad Laboratories, Hercules, CA) set to 250V electric field and 960μFd capacitance, 2~5×10 in the cuvette 7 10μg plasmid DNA linearized with PvuI was added to each cell. Two days after transfection, the medium was changed to a growth medium containing 0.4 mg / mL G418. The anti-human IgG Fc ELISA analysis method was used to screen transfectants resistant to the selected drug. Anti-AT analysis ELISA can also be used to q...

Embodiment 3

[0092] Example 3. Production of Fusion Protein

[0093] The high-yield cell line preferably obtained in Example 2 is firstly cultured in a serum-free culture dish, and then transferred to a shake flask for suspension culture. After the cells are adapted to these culture conditions, they are then fed in a 300ml shake flask. The above-mentioned CHO-derived cell line was cultured in a 100ml shake flask for 16 days, and the cumulative yield of the recombinant fusion protein expressed was 2g / L ( Image 6 ). Between the 6th day and the 12th day of cell culture, the maximum number of living cells is about 7×10 6 Pieces / mL. In order to get more hAT-L-vFc recombinant protein, 2000ml shake flask culture can also be used.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombined dimerization anti-thrombin III-Fc fusion protein, of which the in vitro biological activity is similar to or higher than that of the serum derived anti-thrombin III, and the in vivo half-life period is prolonged. The fusion protein provided by the invention contains human anti-thrombin III (hAT), a flexible peptide joint (L) containing about 20 or less amino acids, and a human IgG Fc mutant (vFC) which is represented by hAT-L-vFC (Fc). Such Fc mutant excludes cracking property and shows extremely low bad-Fc-induced side effect. Such hAT-L-vFC fusion protein is prolonged in serum half-life period and enhanced in the biological activity, so that the pharmacokinetics effect and the pesticide effect are improved. The invention further discloses a method for efficiently expressing or producing such recombined fusion proteins by adopting the mammalian cells.

Description

Technical field [0001] The present invention relates to a recombinant dimerized antithrombin III Fc fusion protein and its preparation method and its medical application, especially in the treatment of various coagulation-related diseases, anti-angiogenesis, anti-inflammatory and anti-virus Aspects of the use. Background technique [0002] The function of the coagulation system in the human body is antagonized by the anticoagulation system. Under normal circumstances, the two maintain a dynamic balance. Antithrombin III (AT) is an important anticoagulant factor in human plasma, which bears 70% of the physiological antithrombin activity in plasma (Johnson DJ et al., EMBO J, 2006, 25: 2029-37), it plays a very important role in maintaining the balance of physiological blood coagulation and anticoagulation. AT is an important member of the Serine Protease Inhibitor (SEPIN) superfamily secreted by hepatocytes and vascular endothelial cells. AT binds to thrombin FIIa to form a thro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/63C12N5/10C12N15/85A61K38/57A61K47/48A61P7/04
Inventor李强周若芸孙乃超
OwnerAMPSOURCE BIOPHARMA (SHANGHAI) INC