Human blood HSP70 antibody colloidal gold-labeled detection test strip and preparation method thereof
A technology for detecting test strips and colloidal gold, applied in biological testing, measuring devices, material inspection products, etc., can solve problems such as inability to apply on-site testing, and achieve the effects of easy observation and judgment, high detection sensitivity, and easy operation.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] The test strips were prepared in the following manner
[0029] 1. Colloidal gold preparation: HAuC1 4 Prepare a concentration of 0.01wt% aqueous solution, take 100ml and heat to boiling. Accurately add 2ml of 1wt% trisodium citrate (C 6 h 5 Na 3 o 7 2H 2 o) Aqueous solution. Continue heating and boiling for 15min. At this time, it can be observed that the light yellow chloroauric acid aqueous solution turns gray soon after sodium citrate is added, then turns black, and then gradually turns red. After cooling to room temperature, restore to the original volume with distilled water.
[0030] 2. Analysis of the quality of colloidal gold: use a multifunctional microplate reader to scan the optical density of colloidal gold in the wavelength range of 400-800nm to obtain its maximum absorption wavelength and half-peak width. The particle size is judged according to the maximum absorption wavelength, and the particle size uniformity is judged according to the half-p...
Embodiment 2
[0038] The test strip prepared in embodiment 1 is to the detection of HSP70 antibody in human serum
[0039] Use the HSP70 antibody ELISA detection kit to detect the blood samples of the population. According to the test results, select 5 blood samples representing HSP70 antibody negative, weak positive and strong positive blood samples from normal human blood samples, moderate stress intensity human blood samples and high stress groups respectively. Take 100 μl of plasma sample from 15 blood samples with a pipette, add it to the sample pad of the colloidal gold test strip, start timing, wait for the red band to appear, and judge the result in 20 minutes.
[0040] Result judgment:
[0041] When the quality control line appears and the detection line appears a line, it indicates that the HSP70 antibody is negative, indicating that the stress level of the body is normal.
[0042] When the quality control line appears and the detection line appears two lines, it indicates that t...
Embodiment 3
[0047] The preparation and purification of HSP70 protein antigen is as follows:
[0048] (1) Design PCR amplification primers and construct prokaryotic expression vectors, in which:
[0049] The upstream primer is: 5'CGAATTCATGGCCAAGAAAACAGCG3'; the downstream primer is: 5'CCCAAGCTTCTAATCCACCTCCTCGAT3', and the HSP70 gene is amplified by PCR.
[0050] The PCR amplification conditions are:
[0051] The first stage: temperature: 95°C, time: 3min;
[0052] The second stage: temperature: 95°C, time: 30s, temperature: 56°C, time: 60s, temperature: 72°C, time: 60s, 30 cycles of the above;
[0053] The third stage: temperature: 72°C, time: 10min.
[0054] After the PCR product is purified, it is digested by EcoRI and Hind III, and then recovered by the gel recovery kit for later use;
[0055] (2) Construction of prokaryotic expression strains
[0056] The expression vector PET32a was digested by EcoRI and Hind III, recovered by the gel recovery kit, connected with the recovered ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| particle diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



