Alpha-galactosidase, and coding gene and application thereof

A galactosidase and gene technology, which is applied to α-galactosidase and its encoding gene and application fields, can solve the problems of few research reports on α-galactosidase, and achieve great application potential and good thermal stability. Effect

Active Publication Date: 2013-04-17
CHINA AGRI UNIV
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there are few domestic research reports on thermostable α-galactosidase

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Alpha-galactosidase, and coding gene and application thereof
  • Alpha-galactosidase, and coding gene and application thereof
  • Alpha-galactosidase, and coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Embodiment 1, the discovery of α-galactosidase and its coding gene

[0064] Table 2 Primers used for cloning of α-galactosidase coding gene

[0065] Primer

5′→3′

Length (bp)

galDF

ATHAARTGGGAYATGAA

17

galDR

TCNGGNCKNGTRTTRTC

17

gal5′GSP

GCCACTGGAGCAGGTTTCAATC

22

gal5'NGSP

CGCTTATAGTGGTGCATGGTGA

22

gal3′GSP

GAACAGACCGTTTGCCGAAGTC

22

gal3'NGSP

TGCTGATTGAAACCTGCTCCAG

22

[0066] Note: In the above degenerate primers galDF and galDR, H=A / C / T, R=A / G, Y=C / T, N=A / T / C / G, K=G / T.

[0067] A pair of primers were designed according to the existing homologous sequences and conserved regions, consisting of galDF and galDR (see Table 2). The genomic DNA of Rhizomucor miehei (Rhizomucor miehei) CAU432 was used as a template, and the primer pair consisting of galDF and galDR was used for PCR amplification. PCR amplification conditions: 95°C for 5min; 95°C for...

Embodiment 2

[0071] Embodiment 2, expression and purification of recombinant α-galactosidase gene

[0072] 1. Construction of recombinant expression vector

[0073] 1. Extract the total RNA of Rhizomucor miehei CAU432 and reverse transcribe it into cDNA.

[0074] 2. Using the cDNA in step 1 as a template, carry out PCR amplification with a primer pair consisting of RmgalAF (38bp) and RmgalAR (45bp), and reclaim the PCR amplification product. The agarose gel electrophoresis of the PCR amplification product is shown in figure 1 (M is DL2000marker, 1 is PCR amplification product).

[0075] RmgalAF: 5′-GGAATTC CATATG CTGGACACTGGCATCCACAAGCACC-3′;

[0076] RmgalAR: 5′-ATAAGAAT GCGGCCGC TTTCTTTTGTACCCAAAACAACAGCGCTTC-3'.

[0077] 3. The PCR amplified product was double-digested with restriction endonucleases Nde I and Not I, and the digested product was recovered.

[0078] 4. Digest the pET-30a(+) vector with restriction endonucleases Nde I and Not I to recover the vector backbone (about...

Embodiment 3

[0106] Embodiment 3, Escherichia coli produces the character of recombinant α-galactosidase

[0107] 1. Determination of optimum pH

[0108] The RmgalA protein solution prepared in Step 3 of Example 2 was used as the solution to be tested.

[0109] Enzyme assay method is the same as the 2 of the step five of embodiment 2, and difference only is to adopt following several damping solutions respectively (concentration is 50mM): citric acid-phosphate buffer (pH 3.0-7.5), citric acid buffer (pH 3.0-6.0, phosphate buffer (pH 6.0-7.5), Tris-Cl buffer (pH 7.5-9.0), CHES buffer (pH 8.0-10.0), Glycine / NaOH buffer (pH 9.0-11.0).

[0110] Citric acid-phosphate buffer solution (indicated by "◆"): prepare 50mM disodium hydrogen phosphate and 50mM citric acid respectively, and mix the two according to different ratios to adjust the pH to pH 3.0-7.5.

[0111] Citric acid buffer (indicated by "■"): Prepare 50mM citric acid and sodium citrate solutions respectively, mix the two in different ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an alpha-galactosidase, and a coding gene and application thereof. The protein provided by the invention is (a) a protein composed of amino acid residues from 24 site to 751<st> site at the N terminal in Sequence 1 in a sequence table; or (b) a protein composed of amino acid sequences shown in Sequence 1 in the sequence table; or (c) a protein which has alpha-galactosidase activity, is derived from Sequence 1 and is formed by the amino acid sequence of (a) or (b) through the substitution and / or deletion and / or addition of one or more amino acid residues. The protein provided by the invention, serving as alpha-galactosidase, has the following enzymatic properties: the optimum pH value is 4.5, and the protein is stable in the pH value range of 4-10; and the optimum temperature is 60 DEG C, the protein is stable within 55 DEG C, the enzyme activity hardly changes when the protein is kept at 55 DEG C for 30 minutes, and 70% of the activity can be remained when the protein is kept at 60 DEG C for 30 minutes, thus indicating favorable heat stability. The protein provided by the invention has great potentials in industrial application.

Description

technical field [0001] The invention relates to an alpha-galactosidase, its coding gene and application. Background technique [0002] α-galactosidase (EC 3.2.1.22, α-galactosidase), also known as melibiase, belongs to the exoglycosidase class, which can specifically hydrolyze the α-galactosidic bond at the non-reducing end of the sugar chain, and is widely used In food processing, feed industry and medicine and other fields. In the food industry, α-galactosidase can be used to prepare soybean milk products with low α-galactosyl oligosaccharide content, which is beneficial to human digestion. In the feed industry, adding α-galactosidase can not only degrade oligosaccharides and improve the metabolic energy of soybean meal, but also eliminate intestinal flatulence and increase animal feed intake. In medicine, using the transferase activity of α-galactosidase, cyclodextrin can be modified to change the physical and chemical properties of the drug, increase the stability of t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/40C12N15/56C12N15/63C12N5/10C12N1/15C12N1/19C12N1/21C12N15/11
Inventor江正强贾会勇闫巧娟波利特宋爽
OwnerCHINA AGRI UNIV