Reorganized mannase, genetically-engineered bacteria of recombined mannose and hydrolyzing preparation mannan oligosaccharide method

A technology of mannanase and genetically engineered bacteria is applied in the fields of recombinant mannanase and genetically engineered bacteria and the preparation of mannose oligosaccharides by hydrolysis, and can solve the problems of low substrate concentration, low hydrolysis efficiency, poor activity, etc. The effect of simplifying processing steps, shortening the process flow, and reducing production costs

Inactive Publication Date: 2013-06-12
HUBEI UNIV +1
View PDF3 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In recent years, there have been more and more researches on oligosaccharides, and a variety of functional oligosaccharide products have been put into the market, but most of the oligosaccharide products are ordinary oligosaccharides, and the active ingredients are less than 50%
The general mannanase activity in production is poor, the hydrolysis efficiency is low, the substrate concentration is low, and it cannot meet the requirements of production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Reorganized mannase, genetically-engineered bacteria of recombined mannose and hydrolyzing preparation mannan oligosaccharide method
  • Reorganized mannase, genetically-engineered bacteria of recombined mannose and hydrolyzing preparation mannan oligosaccharide method
  • Reorganized mannase, genetically-engineered bacteria of recombined mannose and hydrolyzing preparation mannan oligosaccharide method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0192] 1. Construct the recombinant β-mannanase gene according to the first step of the method of the present invention;

[0193] 2. Construct the recombinant expression vector pHBM905BDM according to the second step of the method of the present invention;

[0194] 3. Digest the pHBM905BDM plasmid sequentially with restriction endonucleases Cop I and Not I to produce a vector with two fixed base single-stranded cohesive ends, and recover the vector from agarose gel; secondly, according to the known man gene sequence , use GeneTool software to design two primers, man-1: 5'GTCA ATGTTGCCAAAGGCTTTCTCAGCCCCATCCACTTCTTTCTAG3' and man-45: 5'GGCCATTAATGGTGATGGTGATGGTGAGCAGAACCGATAGCTGCAACAT3', use primerstar DNA polymerase for PCR amplification, and obtain the man (1.1kb) gene fragment, which is agarose After gel recovery, in the presence of dTTP, treat with T4 DNA polymerase at 12°C for 20 min to generate cohesive ends that match with the pHBM905BDM carrier, and recover fragments. T...

Embodiment 2

[0199] The constructed single-copy and two-copy mannanase recombinant strains were respectively inoculated in 50 mL of BMGY medium, cultured at 28°C and 200 r / min for 48 hours, until OD 600 6-9, centrifuge at room temperature at 5000r / min for 5min to collect the bacteria, then transfer the bacteria to 50mL BMMY medium, culture at 28°C and 200r / min, add methanol once every 12h (addition amount is 0.5% of the medium volume), after induced expression, the expression supernatants were taken at 24h, 48h, and 72h respectively for SDS-PAGE electrophoresis, and the protein expression levels at different time periods were analyzed. (See image 3 ).

Embodiment 3

[0201] Mannan-oligosaccharides were prepared by hydrolyzing mannans with different concentrations using the recombinant mannanase crude enzyme solution obtained in shake flasks in Example 2.

[0202] Raw material: guar gum

[0203] 1) The concentrations of the hydrolyzed substrates are respectively prepared to be 10%, 25%, 30%, and 40%;

[0204] Use tap water at a temperature of 50-55°C as a solvent, add an appropriate amount of guar gum, stir, and prepare 100ml of reaction solutions with substrate concentrations of 10%, 25%, 30%, and 40%, and then press the substrate and enzyme Solution ratio 1g: 20ul, add 200ul, 500ul, 600ul, 800ul of crude enzyme solution respectively. No need to adjust pH.

[0205] The hydrolysis times were about 10, 30, 45, 60 minutes, respectively.

[0206] The reaction solution is centrifuged to remove residues, the supernatant is taken for filtration, ultrafiltration, and vacuum spray drying to obtain the finished mannooligosaccharide.

[0207] The...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides reorganized mannase, genetically-engineered bacteria of the recombined mannose and a hydrolyzing preparation mannan oligosaccharide method. The hydrolyzing preparation mannan oligosaccharide method comprises the steps 1), optimizing and reorganizing beta-mannase genes according to pichia pastoris codon preference; 2), constructing expression vector pHBM905BDM-Man containing the beta-mannase genes, converting pitchia pastoris GS115 competence cells, and fostering and checking to obtain single-copy genetically-engineered bacteria; 3) constructing, fostering and checking to obtain multi-copy genetically-engineered bacterium; 4) using different-copy-number genetically-engineered bacteria to efficiently express and prepare reorganized beta-mannase; and 5) using reorganized beta-mannase hydrolysis mannan substrate to produce mannan oligosaccharide. Substrate hydrolysis concentration is 15-40%, temperature is 50 DEG C to 55 DEG C, and time is 0.5 hour to 2 hours. At present, two-copy beta-mannase genetically-engineered bacteria GS115 / MAN78(CCTCCNo:2012554) is high in expression level. The activity of the beta-mannase is 5000U / mL (a decimal number system method), hydrolysis substrate specificity is high, and hydrolysis substrate concentration is obviously higher than that of other methods.

Description

technical field [0001] The invention relates to the construction of a Pichia genetically engineered strain encoding recombinant β-mannanase and a method for expressing mannanase by using Pichia pastoris, and at the same time, using the recombinant mannanase to hydrolyze high-concentration mannan The method for preparing mannan oligosaccharides from sugar does not need to adjust the pH in industrial production, and the operation is simple, which can reduce production costs, shorten the process flow, and simplify subsequent processing steps. Background technique [0002] Mannan oligosaccharides are low-level polymerized sugars formed by 2-10 monosaccharide molecules connected by glycosidic bonds, which can effectively promote the specific proliferation of intestinal beneficial bacteria represented by bifidobacteria in organisms, and have the ability to inhibit It has various physiological functions such as the growth of pathogenic bacteria in the body, reducing the production ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/56C12N1/19C12N15/81C12N9/42C12P19/14C12R1/84
Inventor马立新赵西选喻诗李晔星王亚平姚永兰
OwnerHUBEI UNIV