Check patentability & draft patents in minutes with Patsnap Eureka AI!

Fusion protein of RSV (respiratory syncytial virus) protein F and Fc, and application thereof

A fusion protein and protein technology, which can be used in antiviral agents, medical preparations with non-active ingredients, and medical preparations containing active ingredients, etc. It can solve the damage to cell activity and function, mass spread of viruses, and slow RSV clearance process. problem, to achieve the effect of virus infection enhancement

Active Publication Date: 2013-07-17
WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

FI-RSV also impaired CD8 + T cell activity and function, ultimately leading to slow RSV clearance process, lung damage and massive virus transmission, FI-RSV vaccine ended in failure

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein of RSV (respiratory syncytial virus) protein F and Fc, and application thereof
  • Fusion protein of RSV (respiratory syncytial virus) protein F and Fc, and application thereof
  • Fusion protein of RSV (respiratory syncytial virus) protein F and Fc, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Embodiment 1: the gene of cloning RSV F albumen

[0034] Inoculate 2 × 10 cells per well in a 6-well plate 6 HEp-2 cells were cultured for 12-14 hours, and the cells grew into a monolayer. Remove medium, follow 50TCID 50 Inoculate 500ul of virus into the well plate, incubate at 37°C for 1h, then remove the virus solution, add 2ml of fresh MEM medium containing 2% fetal bovine serum (FBS) to each well, and incubate at 37°C for 48h. The total cellular RNA was extracted with Trizol Reagent (Invitrogen Company), and the obtained total cellular RNA was dissolved in 50 ul of RNase-free water. Then use M-MLV Reverse Transcriptase Kit (Promega Company) and use random primers to reverse transcribe to obtain cDNA.

[0035] According to the gene sequence of RSV (GenBank Accession: AY911262.1), design the forward and reverse primers of the F gene: forward primer GG GGTACC ATGGGATCTAAGGTCCTG (horizontal line marked as KpnI restriction site); reverse primer CCG CTCGAG CTAATTTG...

Embodiment 2

[0037] Example 2. Cloning of human antibody IgG1 constant region Fc gene

[0038] B cells were isolated from fresh plasma, total cellular RNA was extracted with Trizol Reagent (Invitrogen), and the obtained total cellular RNA was dissolved in 50 ul of RNase-free water. Then use the M-MLV Reverse Transcriptase Kit (Promega Company) with oligo(dT) as a primer to reverse transcribe to obtain cDNA.

[0039] Forward and reverse primers of the Fc gene were designed: forward primer GAGCCCAAATCTTGTGACAAAACTC; reverse primer TTTACCCGGAGACAGGGAGAGGC. Using cDNA as a template, the Fc gene fragment was amplified by PCR with KOD DNA polymerase (MBI Company).

[0040] The Fc gene fragment was recovered by agarose gel electrophoresis, connected to the pGEM-T-easy vector (Promega Company) to construct the vector pGEM-T-easy-Fc, and the sequence of the vector was confirmed to be correct.

Embodiment 3

[0041] Embodiment 3. Construction of the fusion gene of RSV F gene and human antibody IgG1 constant region Fc gene

[0042] Primers were designed, and PCR was used to connect the RSV F gene and the Fc gene of the constant region of human antibody IgG1 to construct an F-Fc fusion form. The specific method is as follows:

[0043] First, use the F gene as a template and use the forward primer: GG GGTACC ATGGGATCTAAGGTCCTG (marked as the KpnI restriction site) and reverse primer: CCGCCTCCACCATTTGTGGTTGAT for PCR amplification, extending a sequence overlapping with the Fc gene at the 3' end of the F gene; at the same time, using the Fc gene as a template, use the forward primer : GGAGGTGGCTCTGGCGGTGGCGGATCAGAGCCCAAATC and reverse primer: CCG CTCGAG TCATTTACCCGGAGACAG (the horizontal line marks the XhoI restriction site) was amplified by PCR, and a sequence overlapping with the F gene was extended at the 5' end of the Fc gene; the gene fragment obtained by PCR was recovered, and...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biomedical engineering and discloses a production method of fusion protein (F-Fc) of RSV (respiratory syncytial virus) antigen protein F and antibody constant region Fc, and application of the fusion protein as RSV subunit vaccine. The method includes: establishing a eukaryotic expression vector of the fusion protein containing RSV protein F and human IgG2Fc by molecular cloning, transfecting CHO (Chinese hamster ovary) cells, and expressing the fusion protein; performing protein A affinity chromatography to obtain high-purity fusion protein; performing fusion protein nasal dripping to immunize BABL / c mice to trigger specific mucosal immunity against the RSV, humoral immunity and 'Th1 / Th2 balanced' cellular immunity partial to Th1 type, and thereby effectively inhibiting RSV infections.

Description

technical field [0001] The invention relates to the technical field of biomedical engineering, in particular to a fusion protein (F-Fc) of respiratory syncytial virus (RSV) antigenic protein F and antibody constant region Fc, and its application as an RSV subunit vaccine. Background technique [0002] Respiratory syncytial virus (RSV) is one of the main pathogens that exists worldwide and causes lower respiratory tract infections in infants and young children. RSV infection can cause a series of respiratory diseases, ranging from simple cold symptoms to severe lower respiratory tract infections. Infection and complications. The first infection of RSV mostly occurs in infants aged 2 months, the infection rate is as high as 83%, and there is no lasting immunity after infection, and 50% of infants will be reinfected within 1 to 2 years after the first infection. At the same time, RSV is also a common and serious pathogen in adolescents, the elderly, and immunocompromised popul...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/85A61K47/48A61K39/155A61P31/14
Inventor 肖庚富祖向阳龚睿张哲周拯王薇王宗林金卉侯政刘海滨刘洋徐婷
Owner WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More