Bacillus megatherium SJ-7 strain and application thereof

A technology of Bacillus megaterium and SJ-7, applied in the direction of bacteria, fungicides, chemicals for biological control, etc., can solve the problem of rare multifunctional bacteria, achieve strong inhibitory effect, good potassium solution, and promote The effect of plant growth

Inactive Publication Date: 2013-09-25
YUXI TABACOO COMPANY OF YUNNAN PROVINCE +2
View PDF1 Cites 26 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Bacillus megaterium is commonly used in agriculture to make phosphorus bacterial fertilizers,

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus megatherium SJ-7 strain and application thereof
  • Bacillus megatherium SJ-7 strain and application thereof
  • Bacillus megatherium SJ-7 strain and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0013] Embodiment 1: Obtaining of Bacillus megaterium (Bacillus megaterium) SJ-7 bacterial strain

[0014] In January 2012, it was obtained from soil samples of tomato, cucumber, leek, garlic, green onion, cabbage, and tobacco plantations in Yuxi, Yunnan. Soil samples are collected from the depth of 5-20cm below the surface (remove the surface 5cm floating soil). The soil samples collected from the field are air-dried, and 5g of dry soil samples are weighed and put into 50ml of sterilized water and glass beads. In the Erlenmeyer flask, shake for 1h, then place in 85°C water bath for 30min, and then dilute to 10 -2 、10 -3 , take 200ml peptone plate coated with beef extract, place it at 28°C, culture it for 1-2d, and observe the morphological characteristics of the colony. A single colony was collected and stained with malachite green staining for further microscopic observation. The specific steps of malachite green staining are as follows:

[0015] (1) After smearing the b...

Embodiment 2

[0026] Example 2: Identification of Bacillus megaterium SJ-7

[0027] SJ-7 was identified as Bacillus megaterium by means of 16S rDNA sequence alignment combined with determination of physiological and biochemical characteristics. Specific steps are as follows:

[0028] (1) 16SrDNA sequence analysis

[0029] Genomic DNA of SJ-7 cells was extracted, PCR amplified with bacterial 16S rDNA universal primers (16s F: 5' AGAGTTTGATCCTGGCTCAG3'; 16s R: 5' TACGGCTACCTTGTTACGACT 3'), and then recovered with an agarose gel recovery kit. The recovered and purified PCR product was sent to Shanghai Sangon Biotechnology Company for sequencing (SEQ ID NO1). Using the NCBI website to compare the similarity between the 16S rDNA sequence of SJ-7 bacteria and the 16S rDNA sequences of various bacteria in the database, the results show that the homology between the SJ-716S rDNA sequence and the 16S rDNA sequence of Bacillus megaterium is very high, Up to 99%.

[0030] (2) Morphological and phy...

Embodiment 3

[0036] Embodiment 3: Determination experiment of Bacillus megaterium SJ-7 nitrogen fixation ability

[0037] The nitrogen fixation ability of Bacillus was determined by total nitrogen colorimetry.

[0038] Accurately weigh 0.4716g (NH 4 ) 2 SO 4 , dissolved in water, diluted to 100ml, the liquid contains nitrogen 1.0mg / ml, take this liquid (0, 2.5, 5, 10, 15, 20) μl into a test tube, add water to 3.4ml, add Nessler to each tube Reagent 1.0ml, shake well, heat in a water bath for 15min to fully develop the color, after cooling, measure with a colorimeter at 420nm, and record the absorbance. Use the absorbance as the abscissa and the nitrogen content of the corresponding standard solution as the ordinate to draw a nitrogen standard curve.

[0039] Add 50ml of Ashby medium into a 250ml Erlenmeyer flask, and sterilize at 121°C for 20min. For aseptic operation, each bottle was inoculated with the tested bacteria, and a blank control without inoculation was made at the same time...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Diameteraaaaaaaaaa
Login to view more

Abstract

The invention relates to a bacillus megatherium SJ-7 strain and an application thereof, and belongs to the technical field of organisms. Strain separation, purification and cultivation are carried out from the natural world by a common method, so as to obtain the bacillus megatherium (bacillus megatherium) SJ-7 strain; the bacillus megatherium SJ-7 strain is reserved in the Common Microorganism Center of the China Committee for Culture Collection of Microorganisms; the reservation number is CGMCC No.7169; and the bacillus megatherium SJ-7 strain has strong effects of solubilizing phosphate and potassium and fixing nitrogen, and has good antagonism on a plurality of disease funguses, and can be applied to preparation of a drug for preventing and treating plant fungi diseases. Compared with the reported other bacillus megatherium, the bacillus megatherium SJ-7 disclosed by the invention has the advantages that the bacillus megatherium SJ-7 has good effects of solubilizing potassium, degrading refractory inorganic phosphorus in soil, and fixing nitrogen, can promote plant growth, and has strong inhibitory action on a plurality of plant pathogenic fungi of causing a gibberellic disease, a cotton drooping disease, wheat sharp eyespot and botrytis.

Description

Technical field: [0001] The invention relates to a strain of bacillus megaterium SJ-7 and an application thereof, belonging to the field of biotechnology. Background technique: [0002] Biological control is a method of using organisms or their metabolites to control harmful animal and plant populations or reduce their harm. Now, plant disease biocontrol microorganisms have involved many groups such as fungi, actinomycetes, bacteria and even viruses (phages). Among them, Bacillus is an important class of biocontrol bacteria. It has rich and diverse physiological characteristics, is extremely widely distributed, and is easy to isolate and cultivate. It is an important microbial population in soil, plant surface, and rhizosphere. The outstanding feature of Bacillus is that it can produce heat-resistant and stress-resistant spores, which is beneficial to the production of biocontrol agents, formulation processing and survival, colonization and reproduction in the environment. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N1/20A01P3/00C12R1/11
Inventor 田泽华计思贵张立猛杨海林陈穗云闫春丽扈进冬李纪顺杨合同魏艳丽
Owner YUXI TABACOO COMPANY OF YUNNAN PROVINCE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap