Bacillus megatherium SJ-7 strain and application thereof
A technology of Bacillus megaterium and SJ-7, applied in the direction of bacteria, fungicides, chemicals for biological control, etc., can solve the problem of rare multifunctional bacteria, achieve strong inhibitory effect, good potassium solution, and promote The effect of plant growth
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0013] Embodiment 1: Obtaining of Bacillus megaterium (Bacillus megaterium) SJ-7 bacterial strain
[0014] In January 2012, it was obtained from soil samples of tomato, cucumber, leek, garlic, green onion, cabbage, and tobacco plantations in Yuxi, Yunnan. Soil samples are collected from the depth of 5-20cm below the surface (remove the surface 5cm floating soil). The soil samples collected from the field are air-dried, and 5g of dry soil samples are weighed and put into 50ml of sterilized water and glass beads. In the Erlenmeyer flask, shake for 1h, then place in 85°C water bath for 30min, and then dilute to 10 -2 、10 -3 , take 200ml peptone plate coated with beef extract, place it at 28°C, culture it for 1-2d, and observe the morphological characteristics of the colony. A single colony was collected and stained with malachite green staining for further microscopic observation. The specific steps of malachite green staining are as follows:
[0015] (1) After smearing the b...
Embodiment 2
[0026] Example 2: Identification of Bacillus megaterium SJ-7
[0027] SJ-7 was identified as Bacillus megaterium by means of 16S rDNA sequence alignment combined with determination of physiological and biochemical characteristics. Specific steps are as follows:
[0028] (1) 16SrDNA sequence analysis
[0029] Genomic DNA of SJ-7 cells was extracted, PCR amplified with bacterial 16S rDNA universal primers (16s F: 5' AGAGTTTGATCCTGGCTCAG3'; 16s R: 5' TACGGCTACCTTGTTACGACT 3'), and then recovered with an agarose gel recovery kit. The recovered and purified PCR product was sent to Shanghai Sangon Biotechnology Company for sequencing (SEQ ID NO1). Using the NCBI website to compare the similarity between the 16S rDNA sequence of SJ-7 bacteria and the 16S rDNA sequences of various bacteria in the database, the results show that the homology between the SJ-716S rDNA sequence and the 16S rDNA sequence of Bacillus megaterium is very high, Up to 99%.
[0030] (2) Morphological and phy...
Embodiment 3
[0036] Embodiment 3: Determination experiment of Bacillus megaterium SJ-7 nitrogen fixation ability
[0037] The nitrogen fixation ability of Bacillus was determined by total nitrogen colorimetry.
[0038] Accurately weigh 0.4716g (NH 4 ) 2 SO 4 , dissolved in water, diluted to 100ml, the liquid contains nitrogen 1.0mg / ml, take this liquid (0, 2.5, 5, 10, 15, 20) μl into a test tube, add water to 3.4ml, add Nessler to each tube Reagent 1.0ml, shake well, heat in a water bath for 15min to fully develop the color, after cooling, measure with a colorimeter at 420nm, and record the absorbance. Use the absorbance as the abscissa and the nitrogen content of the corresponding standard solution as the ordinate to draw a nitrogen standard curve.
[0039] Add 50ml of Ashby medium into a 250ml Erlenmeyer flask, and sterilize at 121°C for 20min. For aseptic operation, each bottle was inoculated with the tested bacteria, and a blank control without inoculation was made at the same time...
PUM
Property | Measurement | Unit |
---|---|---|
Diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com