Construction and application of PTEN gene overexpression recombinant adenoviral vectors
A gene overexpression and recombinant adenovirus technology, applied in the fields of animal molecular biology and genetic engineering, can solve problems such as gene mutation and carcinogenesis, and achieve the effects of promoting oxidative metabolism, enhancing transport capacity, and increasing assembly and secretion.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] According to the PTEN gene mRNA sequence published by Genbank, fluorescent quantitative PCR primers were designed and synthesized, and sent to Shanghai Sangong for synthesis. The specific sequence of the primer is: F: AAGCTTATGAGAGACGGCGGCGG (SEQ ID NO.2); R: GGATCCTCAGACTTTTGTAATTTGTGTATGC (SEQ ID NO.3).
[0034] A small amount of cow liver tissue was collected by liver puncture and quickly put into liquid nitrogen for the extraction of total RAN. The total RNA of liver tissue was extracted by TRIZOL method, reverse-transcribed into cDNA, and stored at -80°C for future use.
[0035] Using cDNA as a template, the target gene was amplified by PCR. The reaction system is 10×PCR Buffer 2.5 μL, dNTP Mixture 2.0 μL, template cDNA 2.0 μL, upstream primer (10 μM / μL) 1.0 μL, downstream primer (10 μM / μL) 1.0 μL, TaKaRa Ex Taq (5U / μL) 0.25 μL , dd H 2 O 16.25 μL, total volume 25.0 μL.
[0036] The PCR reaction conditions were: pre-denaturation at 94°C for 5 min; denaturation ...
Embodiment 2
[0040] This example illustrates the construction of a recombinant shuttle vector.
[0041] Digest the pShuttle-CMV-EGFP recombinant shuttle vector with endonuclease EcoRV / SalI (CIP dephosphorylation treatment), and cut the gel after 1% gel electrophoresis to recover the target gene fragment of about 5.1Kb vector, because the UV irradiation for too long may DNA is damaged, so no electropherogram is saved in this step. The specific enzyme digestion system and reaction conditions are shown in Table 1.
[0042] Table 1 Shuttle plasmid digestion system and reaction conditions
[0043]
[0044]
[0045] The original plasmid carrying the full expression sequence of PTEN was digested with EcoRV / XhoI, after 1% gel electrophoresis, the target fragment was cut out under ultraviolet light, and the DNA gel recovery and purification kit (column centrifugal type) was used (specific steps Refer to the instructions of the kit, which are omitted here) Steps such as recovery and purifica...
Embodiment 3
[0053] This example is used to illustrate the enzyme digestion identification of the recombinant shuttle plasmid.
[0054] Use BamHI (overexpressed recombinant shuttle plasmid) endonuclease to identify the recombinant shuttle plasmid, and the expected results are: the negative clone of the overexpressed recombinant shuttle plasmid is a 5.1kb band; the positive insertion clone is 1.2kb / 5.1Kb two straps. The enzyme digestion identification system and reaction conditions are shown in Table 4. After enzyme digestion, 1% agarose gel electrophoresis was taken, and the results were as follows: figure 2 shown.
[0055] Table 4 Recombinant Shuttle Plasmid Enzyme Digestion Identification System and Reaction Conditions
[0056]
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com