Construction and application of PTEN gene overexpression recombinant adenoviral vectors

A gene overexpression and recombinant adenovirus technology, applied in the fields of animal molecular biology and genetic engineering, can solve problems such as gene mutation and carcinogenesis, and achieve the effects of promoting oxidative metabolism, enhancing transport capacity, and increasing assembly and secretion.

Inactive Publication Date: 2013-12-25
HEILONGJIANG BAYI AGRICULTURAL UNIVERSITY
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the disadvantages of the lentiviral vector delivery system are similar to those of the retrovirus. It can also integrate the transferred exogenous gene into the host cell genome, which has certain risks to the gene expression of the host cell and may cause gene mutation and canceration. Wait

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction and application of PTEN gene overexpression recombinant adenoviral vectors
  • Construction and application of PTEN gene overexpression recombinant adenoviral vectors
  • Construction and application of PTEN gene overexpression recombinant adenoviral vectors

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] According to the PTEN gene mRNA sequence published by Genbank, fluorescent quantitative PCR primers were designed and synthesized, and sent to Shanghai Sangong for synthesis. The specific sequence of the primer is: F: AAGCTTATGAGAGACGGCGGCGG (SEQ ID NO.2); R: GGATCCTCAGACTTTTGTAATTTGTGTATGC (SEQ ID NO.3).

[0034] A small amount of cow liver tissue was collected by liver puncture and quickly put into liquid nitrogen for the extraction of total RAN. The total RNA of liver tissue was extracted by TRIZOL method, reverse-transcribed into cDNA, and stored at -80°C for future use.

[0035] Using cDNA as a template, the target gene was amplified by PCR. The reaction system is 10×PCR Buffer 2.5 μL, dNTP Mixture 2.0 μL, template cDNA 2.0 μL, upstream primer (10 μM / μL) 1.0 μL, downstream primer (10 μM / μL) 1.0 μL, TaKaRa Ex Taq (5U / μL) 0.25 μL , dd H 2 O 16.25 μL, total volume 25.0 μL.

[0036] The PCR reaction conditions were: pre-denaturation at 94°C for 5 min; denaturation ...

Embodiment 2

[0040] This example illustrates the construction of a recombinant shuttle vector.

[0041] Digest the pShuttle-CMV-EGFP recombinant shuttle vector with endonuclease EcoRV / SalI (CIP dephosphorylation treatment), and cut the gel after 1% gel electrophoresis to recover the target gene fragment of about 5.1Kb vector, because the UV irradiation for too long may DNA is damaged, so no electropherogram is saved in this step. The specific enzyme digestion system and reaction conditions are shown in Table 1.

[0042] Table 1 Shuttle plasmid digestion system and reaction conditions

[0043]

[0044]

[0045] The original plasmid carrying the full expression sequence of PTEN was digested with EcoRV / XhoI, after 1% gel electrophoresis, the target fragment was cut out under ultraviolet light, and the DNA gel recovery and purification kit (column centrifugal type) was used (specific steps Refer to the instructions of the kit, which are omitted here) Steps such as recovery and purifica...

Embodiment 3

[0053] This example is used to illustrate the enzyme digestion identification of the recombinant shuttle plasmid.

[0054] Use BamHI (overexpressed recombinant shuttle plasmid) endonuclease to identify the recombinant shuttle plasmid, and the expected results are: the negative clone of the overexpressed recombinant shuttle plasmid is a 5.1kb band; the positive insertion clone is 1.2kb / 5.1Kb two straps. The enzyme digestion identification system and reaction conditions are shown in Table 4. After enzyme digestion, 1% agarose gel electrophoresis was taken, and the results were as follows: figure 2 shown.

[0055] Table 4 Recombinant Shuttle Plasmid Enzyme Digestion Identification System and Reaction Conditions

[0056]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to mRNA of PTEN genes. The nucleotide sequence is shown as SEQ ID NO.1. The invention further provides PTEN gene overexpression recombinant adenoviral vectors, namely, the mRNA of the PTEN genes is inserted into multiple cloning sites of the adenoviral vectors, and the invention further provides a construction method and purposes of the PTEN gene overexpression recombinant adenoviral vectors. The PTEN gene overexpression recombinant adenoviral vectors constructed through the method can cause overexpression of the PTEN genes, can promote oxidative metabolism of fatty acid, and can effectively increase and determine assembly and secretion of VLDL. Moreover, the PTEN gene overexpression recombinant adenoviral vectors can enhance transport capacity of triglyceride and can be used for treating fatty liver in dairy cows.

Description

technical field [0001] The invention belongs to the field of animal molecular biology and genetic engineering, and relates to the construction and application of a PTEN gene overexpression recombinant adenovirus vector. Background technique [0002] Fatty liver of dairy cows during the peripartum period is a metabolic disease caused by the negative energy balance of dairy cows during the transition period. However, due to the lack of effective control measures, it has brought huge losses to the cattle industry, and it is urgent to find an effective treatment method. In view of the weak liver fatty acid oxidation ability of peripartum dairy cows (especially Holstein cows), the insufficient ability to synthesize and secrete lipoproteins is the main link in the occurrence of fatty liver, and the establishment of gene therapy to regulate liver fatty acid oxidation and VLDL secretion and synthesis may be possible. It can provide new ideas for the prevention and treatment of fatty...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/55C12N15/861C12N15/66A61K48/00A61P1/16
Inventor 付世新罗春海贺显晶沈冰蕾郭景茹
Owner HEILONGJIANG BAYI AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap