Method for producing alpha-phenylpyruvic acid efficiently through whole cell transformation

A technology of whole cell conversion and phenylpyruvate, applied in the field of fermentation engineering, can solve the problems of pollution, low yield, high cost, etc., and achieve the effect of solving high energy consumption

Inactive Publication Date: 2014-03-19
JIANGNAN UNIV
View PDF1 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The technical problem to be solved in the present invention is to provide a method for efficiently producing PPA by whole cell transformation, which is to express the deaminase gene derived from P. mirabilis KCTC2566 heterologously in E. Alanine produces PPA, thus solving the problems of high cost, low yield and serious pollution in industrial PPA production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing alpha-phenylpyruvic acid efficiently through whole cell transformation
  • Method for producing alpha-phenylpyruvic acid efficiently through whole cell transformation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Embodiment 1L-Amino acid deaminase recombinant plasmid construction

[0021] Using P. mirabilis KCTC2566 genomic DNA as a template, use the following primers to amplify the target gene:

[0022] 5'CGC GGATCC ATGAACATTTCAAGGAGAAAGCTAC3' (forward primer) and

[0023] 5'CCG CTCGAG TTACTTCTTAAAACGATCCAAACTAA3' (reverse primer), the underlined parts are the restriction sites of BamH I and Xho I, respectively. The obtained target gene sequence is shown in SEQ ID NO.1. After the PCR product is purified and digested, it is connected with the vector pET-20b(+) to construct the recombinant plasmid pET-pma (such as figure 1 ).

Embodiment 2

[0024] Embodiment 2 recombinant escherichia coli construction

[0025] Transform the recombinant plasmid pET-pma of Example 1 into the cloning host E.coli JM109, pick a single colony grown on the LB ampicillin resistance plate, PCR amplify, pick out the positive transformant to extract the plasmid, double enzyme digestion verification, the band Sequencing is performed correctly, and the expression host E.coli BL21 is transformed and expressed with the correct sequence. Transformed BL21 plate single colony inoculation seed medium for overnight culture, inoculated 1% of the inoculum into the fermentation medium, cultured at 37°C until OD was 1.0, added IPTG with a final concentration of 0.4mM, and induced at 30°C for 5h.

Embodiment 3

[0026] Example 3 Whole Cell Conversion L-Phenylalanine Condition Optimization

[0027] The recombinant Escherichia coli-induced cells of Example 2 were collected, and transformed into whole cells in a Tris-HCl (pH=7.6) solution. When the cell concentration is 12.6g / L (dry cell weight), in different concentrations of L-phenylalanine (2g / L, 4g / L, 8g / L, 14g / L, 20g / L, 24g / L) conditions at 37°C for 12 hours to investigate the effect of the substrate concentration on the transformation. When the optimal L-phenylalanine concentration was 14g / L, the conversion rate reached a maximum of 20.4%; when the L-phenylalanine concentration was 14g / L , adding different concentrations of biocatalysts (1.4g / L, 4.2g / L, 8.4g / L, 12.6g / L, 16.8g / L, 25.2g / L, cell dry weight), 37 ℃, transformation 12h, research The effect of cell concentration on transformation, when the optimal cell concentration is 8.4g / L, the conversion rate is 23.7%; under the condition of optimal substrate concentration and cell c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for producing alpha-phenylpyruvic acid efficiently through whole cell transformation and belongs to the fermentation engineering field. Heterologous expression of P. mirabilis amino acid deaminases is carried out in colibacillus. L-phenylalanine is transformed by utilization of the strains to produce alpha-phenylpyruvic acid. The transformation conditions are optimized, and efficient production of alpha-phenylpyruvic acid through whole cell transformation is achieved. Compared with traditional chemical methods, the method is advantaged by low cost, simple operation, environmental protection, and lays the foundation for industrial biotransformation production of alpha-phenylpyruvic acid.

Description

technical field [0001] The present invention relates to a method for the efficient production of α-phenylpyruvate through whole cell transformation, in particular expressing a recombinant deaminase gene in Escherichia coli, and transforming L-phenylalanine with this strain to produce α-phenylpyruvate, which belongs to fermentation engineering field. Background technique [0002] α-Phenylpyruvate (PPA) is the raw material for the synthesis of D-phenylalanine, which is a chiral drug intermediate. PPA can also be used to prepare phenyllactic acid, which can be used as an antibacterial substance. At present, the production of PPA is mainly chemical synthesis, mainly including: acetamidocinnamic acid hydrolysis method, hydantoin and benzaldehyde synthesis method and hydantoin method. These methods all require multi-step reactions and have high requirements for reaction conditions, such as high pressure, high temperature, etc., and the product yield is low, which increases the d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/70C12P7/40C12R1/19
Inventor陈坚刘龙堵国成李江华侯颖
OwnerJIANGNAN UNIV