Pig muscular tissue specificity induced expression system
A technology of induced expression and specificity, which is applied in the field of animal genetic engineering, can solve the problem of no tissue-specific expression of the target gene expression plasmid, and achieve the effect of biological safety guarantee
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] Example 1: Obtaining the core fragment of the promoter of the pig's skeletal muscle-specific expression gene α-actin
[0049] Utilize the core sequence of the reported porcine α-actin gene promoter in the gene regulatory sequence -1089bp~-821bp region (GenBank accession number: 100154254 ), using Primer5 by designing specific primers (actinF:ATAAGAAT GCGGCC GCCCAGCCCGGGAGACACTC;actinR:AA CTGCAG GCTGCGGTGGCCGCTGGT, the underline is the restriction site), using the large white pig blood genome DNA as a template, PCR amplifies this sequence, the results are shown in Figure 7 . The amplification conditions are: 94°C for 5min, 35*(94°C, 40sec; 72°C, 40sec; 72°C, 30sec); 72°C, 10min; 25°C, 2min. The amplified product was detected by 1.5% agarose electrophoresis, and the target fragment was recovered and purified by using the UNIQ-10 Column DNA Gel Recovery Kit (operated according to the instructions of the kit) produced by Beijing Broadtech Biogene Technology Co., Ltd.,...
Embodiment 2
[0056] Example 2: Construction of recombinant plasmid pVg-8 and reaction plasmid pIND-LacZ transfection plasmid of porcine muscle-specific induction expression system
[0057] (1) Construction of recombinant plasmid pVg-8
[0058] (1) Use the primers shown in Table 1 to amplify the ZP and Q8 fragments and then perform TA cloning and ligation to obtain plasmids T-ZP and T-Q8, respectively, and use Sph Ⅰ and Not Ⅰ double enzymes to cut T-Q8 and T-ZP, See Table 3 for enzyme digestion system:
[0059] Table 3 enzyme digestion system
[0060] 10×buffer2
2μL
5μL
100× bovine serum albumin (BSA)
0.2 μL
Sph I (NEB)
0.5μL
Not Ⅰ (NEB)
0.5μL
double distilled water
11.8μL
[0061] After digestion at 37°C for 3 hours, use 1.5% agarose gel electrophoresis to detect the integrity of the digestion and recover the target fragment, and recover it with the UNIQ-10 column DNA gel recovery kit produced by Beijing...
Embodiment 3
[0085] Example 3: Transfection of cells using liposome-mediated method
[0086] 24-well cell culture dishes were used for cell transfection. In order to eliminate experimental errors, three rounds of independent experiments were carried out for each recombinant plasmid, and three replicate holes were made for each experiment. According to Lipofectamine TM 2000 (purchased from Invitrogen Company) specification, each well was transfected according to the ratio of plasmid mass: liposome volume ratio = 1 μg: 3 μL. After transfection of the mouse muscle cell line C2C12 (referred to as: muscle cell C2C12, purchased from the Cell Bank of the Chinese Academy of Sciences, Shanghai, China), the G418 drug (purchased from Wuhan Life Technology Co., Ltd.) was used for screening, and the initial screening concentration was 600ng / μL, the concentration of G418 after screening positive clone cells was 300ng / μL. After that, 2% horse serum was used to induce C2C12 cells to differentiate into...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
