Pig muscular tissue specificity induced expression system

A technology of induced expression and specificity, which is applied in the field of animal genetic engineering, can solve the problem of no tissue-specific expression of the target gene expression plasmid, and achieve the effect of biological safety guarantee

Inactive Publication Date: 2014-07-16
HUAZHONG AGRI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] So far, except for the applicant, there have been no reports of tissue-specific expression of the target gene and expression

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pig muscular tissue specificity induced expression system
  • Pig muscular tissue specificity induced expression system
  • Pig muscular tissue specificity induced expression system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1: Obtaining the core fragment of the promoter of the pig's skeletal muscle-specific expression gene α-actin

[0049] Utilize the core sequence of the reported porcine α-actin gene promoter in the gene regulatory sequence -1089bp~-821bp region (GenBank accession number: 100154254 ), using Primer5 by designing specific primers (actinF:ATAAGAAT GCGGCC GCCCAGCCCGGGAGACACTC;actinR:AA CTGCAG GCTGCGGTGGCCGCTGGT, the underline is the restriction site), using the large white pig blood genome DNA as a template, PCR amplifies this sequence, the results are shown in Figure 7 . The amplification conditions are: 94°C for 5min, 35*(94°C, 40sec; 72°C, 40sec; 72°C, 30sec); 72°C, 10min; 25°C, 2min. The amplified product was detected by 1.5% agarose electrophoresis, and the target fragment was recovered and purified by using the UNIQ-10 Column DNA Gel Recovery Kit (operated according to the instructions of the kit) produced by Beijing Broadtech Biogene Technology Co., Ltd.,...

Embodiment 2

[0056] Example 2: Construction of recombinant plasmid pVg-8 and reaction plasmid pIND-LacZ transfection plasmid of porcine muscle-specific induction expression system

[0057] (1) Construction of recombinant plasmid pVg-8

[0058] (1) Use the primers shown in Table 1 to amplify the ZP and Q8 fragments and then perform TA cloning and ligation to obtain plasmids T-ZP and T-Q8, respectively, and use Sph Ⅰ and Not Ⅰ double enzymes to cut T-Q8 and T-ZP, See Table 3 for enzyme digestion system:

[0059] Table 3 enzyme digestion system

[0060] 10×buffer2

2μL

plasmid DNA

5μL

100× bovine serum albumin (BSA)

0.2 μL

Sph I (NEB)

0.5μL

Not Ⅰ (NEB)

0.5μL

double distilled water

11.8μL

[0061] After digestion at 37°C for 3 hours, use 1.5% agarose gel electrophoresis to detect the integrity of the digestion and recover the target fragment, and recover it with the UNIQ-10 column DNA gel recovery kit produced by Beijing...

Embodiment 3

[0085] Example 3: Transfection of cells using liposome-mediated method

[0086] 24-well cell culture dishes were used for cell transfection. In order to eliminate experimental errors, three rounds of independent experiments were carried out for each recombinant plasmid, and three replicate holes were made for each experiment. According to Lipofectamine TM 2000 (purchased from Invitrogen Company) specification, each well was transfected according to the ratio of plasmid mass: liposome volume ratio = 1 μg: 3 μL. After transfection of the mouse muscle cell line C2C12 (referred to as: muscle cell C2C12, purchased from the Cell Bank of the Chinese Academy of Sciences, Shanghai, China), the G418 drug (purchased from Wuhan Life Technology Co., Ltd.) was used for screening, and the initial screening concentration was 600ng / μL, the concentration of G418 after screening positive clone cells was 300ng / μL. After that, 2% horse serum was used to induce C2C12 cells to differentiate into...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical field of animal genetic engineering, and particularly relates to construction of a muscular tissue specificity expression system. The muscular tissue specificity expression system is constructed by a core promoter of a pig skeletal muscle specificity expressed gene alpha-actin and an ecdysone induced expression system and can be used for realizing specific expression of target genes in muscles and accurate expression of the target genes. The muscular tissue specificity expression system is characterized in that an adjusting plasmid in the ecdysone induced expression system is replaced by the core promoter zone of the pig skeletal muscle specificity expressed gene, a beta-galactosidase reporter gene is inserted in multiple cloning sites of a reaction substance of the ecdysone induced system, and two recombinant vectors are used as issue specificity induced expression systems and are co-transfected to rat C2C12 cells and myotubes. The constructed muscular tissue specificity expression system has independent starting activity and muscular tissue specificity and is capable of adjusting and controlling the expression of the target genes under the effects of induction time and induction dosage.

Description

technical field [0001] The invention belongs to the technical field of animal genetic engineering, and specifically relates to the combination of pig skeletal muscle-specific promoter α-actin and ecdysone inducible expression system to construct a muscle-specific inducible expression system, and whether the system has both tissue specificity and potential Induced functional verification. Background technique [0002] As a cis-acting element for the regulation of eukaryotic gene expression, the promoter contains important information of the gene expression regulatory network and determines the intensity and specificity of gene expression (Kim et al., 2005). Whether foreign genes can be efficiently and stably expressed in the body is the key to genetic engineering research. It is already a common technology to construct various eukaryotic expression systems by genetic engineering technology in eukaryotic cells to express exogenous genes, but the problem often faced is that th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/113C12N15/85C12N15/66
Inventor 蒋思文杨永兰
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap