Indirect ELISA (enzyme-linked immuno sorbent assay) kit for detecting haemophilus parasuis antibody
A technology of Haemophilus suis and a kit, which is applied in molecular biology, microbiology, detection of animal infectious diseases, and prevention and control of Haemophilus parasuis disease, achieving high biological safety, high homology, and good specificity Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] 1. Cloning, sequencing, expression and purification of Haemophilus parasuis CDT-C protein
[0041] 1.1 Primer design and synthesis
[0042] According to the SH0165 (accession number CP001321) H. parasuis CDT-C complete gene sequence in GenBank, design a pair of expression primers, P (CDTC-BamHI-F): CGC GGATCC ATGCTAAAGCGTTTTACTTT, under P (CDTC-SalI-R): ACGT GTC GAC The upstream and downstream primers of TTATAATAACCTACTAGGTC introduced BamHI and SalI restriction sites (underlined) respectively to amplify the CDT-C OFR sequence. The expected fragment size is 531bp.
[0043] 1.2 Cloning and sequencing analysis of the CDT-C gene of Haemophilus parasuis
[0044] Using the extracted H. parasuis serum type 1-15 DNA as a template, P up and P down were used as primers. The total reaction system is 25 μL, Taq enzyme: 0.25 μL; MgCl2 buffer: 2.5 μL; MgCl2: 2.5 μL; dNTP: 2 μL; F1: 1 μL; R1: 1 μL; ddH2O: 13.75 μL; DNA template 2 μL. The reaction program was: 94 °C pre-...
Embodiment 2
[0064] Development of an indirect ELISA kit for detecting antibodies against Haemophilus parasuis
[0065] 1. Expression, extraction, purification and storage of antigens in Haemophilus parasuis ELISA antibody detection kit
[0066] Inoculate the production-use Escherichia coli seeds carrying Haemophilus parasuis CDT-C protein in LB liquid medium (containing 100 μg / mL ampicillin sodium), cultivate overnight at 37 °C, and transfer to LB liquid medium at a ratio of 1:100 (containing 100 μg / mL ampicillin sodium), shake culture at 37°C until OD 600nm When the value reaches about 0.6, add the final concentration of 0.5mM IPTG to the bacterial liquid, place it in a shaker at 16°C to induce expression for 24 hours, collect the bacterial liquid, freeze and thaw three times at -70°C and 37°C, and then ultrasonically break (300W , work for 5 s, interval of 10 s) 70 times. The collected protein was purified with Octave? Ni-NTA SF Columns affinity chromatography column. Purified protei...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com