Unlock instant, AI-driven research and patent intelligence for your innovation.

Pear transcription factor psjointless and its application

A transcription factor and gene technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of functions that need to be further verified and limited research, and achieve the effect of achieving environmental friendliness and reducing agricultural costs

Active Publication Date: 2017-03-22
NANJING AGRICULTURAL UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It must be pointed out that although JOINTLESS sequences have been cloned from different species, the function of most JOINTLESS sequences in the process of organ shedding remains to be further verified
In addition, most of the information about JOINTLESS comes from Solanaceae plants, such as tomato, pepper, etc., but the research about JOINTLESS of fruit trees is very limited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pear transcription factor psjointless and its application
  • Pear transcription factor psjointless and its application
  • Pear transcription factor psjointless and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 PsJOINTLESS gene isolation, cloning and expression analysis

[0035] RNA was extracted from the calyx of'Korla Fragrant Pear', and the first strand cDNA obtained by reverse transcription was used to amplify the full length of the PsJOINTLESS gene.

[0036] The RNA was extracted using the Trizol kit (purchased from TakaRa, operated in accordance with the operating instructions provided by the kit), and 1 μg of total RNA sample was extracted with 1 U DNase (purchased from Thermo). The first strand cDNA synthesis uses TOYOBO reverse transcription kit (operate according to the instructions provided by the kit). The primer pairs for the amplified gene are: PsJOINTLESS-F1: 5'-ATGGATGGCGAGGGAGAAAATTCAG-3' (SEQ ID No. 3); PsJOINTLESS-R1: 5'-GGTCACCTTATCAGATGACTTAAACGCAC-3' (SEQ ID No. 4). The 50 μL reaction system includes 200 ng cDNA, 1× buffer (TransStart FastPfu Buffer), 10 mM dNTP, 1 U Taq polymerase (TransStart FastPfu DNA Polymerase) (the aforementioned buffer and T...

Embodiment 2

[0039] Example 2 Subcellular localization of PsJOINTLESS gene

[0040] Since PsJOINTLESS gene has a nuclear localization signal (NLS), this study used Agrobacterium to infect onion epidermis to study the subcellular localization of PsJOINTLESS gene. The entire ORF (reading frame) of the PsJOINTLESS gene was amplified by RT-PCR, and Nco I and Spe I were added at both ends of the amplification primers. Firstly, the amplified product is loaded on the pMD19-T vector to obtain a pMD19-TN / S-PsJOINTLESS recombinant vector. At the same time, pMD19-TN / S-PsJOINTLESS and pCAMBIA1302 were digested with Nco I and Spe I, and the recovered genes were connected with the vector backbone to obtain the pCAMBIA-1302-PsJOINTLESS-GFP recombinant plasmid. The recombinant plasmid was double-enzymed Digestion identification, the correct recombinant plasmid identified by double enzyme digestion was sequenced, and the results showed that the obtained recombinant plasmid pCAMBIA-1302-PsJOINTLESS-GFP was co...

Embodiment 3

[0041] Example 3 Construction of plant transformation overexpression vector

[0042] According to the analysis of the multiple cloning site of pCAMBIA-1301 vector and the restriction site analysis on the coding region sequence of PsJOINTLESS gene, Nco I and BstE II were selected as endonucleases. According to the general principle of designing primers, use PrimerPrimer3.0 software to design primers with restriction sites. The primer pair sequence is as follows:

[0043] PsJOINTLESS-F3:TG CCATGG TGATGGCGAGGGAGAAAATTCAG (SEQ ID NO. 7)

[0044] PsJOINTLESS-R3:GG GGTCACC TTATCAGATGACTTAAACGCAC (SEQ ID NO. 8)

[0045] Using the correctly sequenced preserved bacterial solution to extract the plasmid as a template, clone the gene containing restriction enzyme sites. The annealing temperature for PCR amplification is 52°C, and the PCR reaction system and amplification procedure are the same as in Example 1. Recover the band of interest and connect it to the pMD19-T vector to construct a ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a pear transcription factor PsJOINTLESS and an application thereof. A transcription factor PsJOINTLESS gene which is separated from a Korla pear and has the function of promoting plant organ abscission belongs to the MADS-box family, the nucleotide sequence is shown as SEQ ID NO.1, and the coded amino acid sequence is shown as SEQ ID NO.2. The transcription factor is transformed into a tomato with an agrobacterium tumefaciens-mediated genetic transformation method, and a transgenic plant is obtained; biological functions prove that the cloned PsJOINTLESS gene has the function of promoting plant organ abscission. By aid of discovery of the PsJOINTLESS gene, novel gene resources are provided for molecular breeding for promoting plant organ abscission, novel genetic resources are provided for implementation of green agriculture, and development and utilization of the genetic resources facilitate agricultural cost reduction and implementation of environmental friendliness.

Description

Technical field [0001] The invention belongs to the field of plant genetic engineering, and relates to the pear transcription factor PsJOINTLESS and its application, and specifically relates to the separation and cloning of a plant organ shedding related MADS-box family member PsJOINTLESS gene and its application from ‘Korla Fragrant Pear’. Background technique [0002] Organ shedding refers to the physiological process by which plant cells, tissues or organs are separated from the mother. Organ shedding is the result of changes in cell structure, metabolism and gene expression. In general, the tissue area from which organs or tissues fall off and its neighboring parts are called "abscission zone", and only several layers of cells in this area where tissue and cells are separated are called "abscission zone". Observation of the anatomical structure of the separation zone of a variety of plants and horticulture plant organs shows that there are three types of separation cell size...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/84C12N1/21C12N15/11A01H5/00
Inventor 张绍铃齐笑笑黄小三
Owner NANJING AGRICULTURAL UNIVERSITY