Chloroplast iron transporter gene NtPIC1 and application thereof
A technology for transferring genes and chloroplasts, which is applied in the fields of application, genetic engineering, plant genetic improvement, etc., to achieve the effect of great application prospects.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1. A full-length cDNA clone of tobacco chloroplast iron transport gene NtPIC1.
[0024] Search the tobacco EST sequence from the NCBI database (http: / / www.ncbi.nlm.nih.gov / ) and save it, use the Arabidopsis thaliana AtPIC1 sequence known in the database to edit the preserved tobacco EST sequence in the BioEdit software Text file carries out Local Blast, thus just obtained PIC1 gene EST sequence in tobacco.Utilize this sequence design primer, and primer is:
[0025] NtPIC1-F1: 5'-CGAACAAAACTAGCTATGCAAAC-3';
[0026] NtPIC1-R1: 5'-GACTCCCAATCACTTCATGC-3'.
[0027] The specific process is as follows:
[0028] RNA extraction: TRIZOL kit was used to extract RNA from tobacco (Nicotiana tabacum cv. SR-1) young leaves, reverse-transcribed it into cDNA, and amplified the full-length sequence of NtPIC1 by RT-PCR using this cDNA as a template.
[0029] RT-PCR reaction: KOD-plus DNA polymerase (Toyobo) was used for RT-PCR reaction, reaction program: 94°C pre-denaturation...
Embodiment 2
[0031] Example 2. Subcellular localization of tobacco chloroplast iron transport gene NtPIC1.
[0032] 1. Carrier Construction
[0033] Firstly, the sequence containing the full-length coding region of NtPIC1 gene (without terminator) was obtained by PCR, and the primers used contained BamHI and SacI restriction sites:
[0034] NtPIC1-BamHI: CGCGGATCCATGCAAACTCTACTTCTTG;
[0035] NtPIC1-SacI-1: CGAGCTCTGCAATCCTTGGTAC.
[0036] Digest the PCR product with SacI, and recover the fragment for smoothing: DNA 21 μL, KOD 1.5 μL, 10×Blunting Buffer 4 μL, H 2 O 3.5 μL. Smoothing reaction conditions: keep warm at 72°C for 5 minutes, and immediately cool at 4°C to stop the smoothing reaction. Phenol chloroform recovered smooth product. Then digest with BamHI, identify by 1% agarose gel electrophoresis, and recover the digested product; pBI221 (Biovector) vector is first digested with SmaI to produce blunt ends, and recover the digested product with phenol chloroform; then digest with ...
Embodiment 3
[0046] Example 3. Functional analysis of tobacco chloroplast iron transport gene NtPIC1.
[0047] 1. Construction of yeast expression vector
[0048] Use the following pair of primers to introduce BamHI and SacI restriction sites at the 5' and 3' ends of NtPIC1 respectively:
[0049] NtPIC1-BamHI: CGCGGATCCATGCAAACTCTACTTCTTG;
[0050] NtPIC1-SacI-2: CGAGCTCTCATGCAATCCTTGGTAC.
[0051] Digest the PCR product with SacI, and recover the fragment for smoothing: DNA 21 μL, KOD 1.5 μL, 10×Blunting Buffer 4 μL, H 2 O 3.5 μL. Smoothing reaction conditions: keep warm at 72°C for 5 minutes, and immediately cool at 4°C to stop the smoothing reaction. Phenol chloroform recovered smooth product. Re-digestion with BamHI, the obtained PCR product was identified by 1% gel electrophoresis, and the gel was recovered. Yeast expression vector pYES2.0 (purchased from Invitrogen) was first digested with NotI, smoothed (same as above), then digested with BamHI, and the digested product was re...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 