Chloroplast iron transporter gene NtPIC1 and application thereof

A technology for transferring genes and chloroplasts, which is applied in the fields of application, genetic engineering, plant genetic improvement, etc., to achieve the effect of great application prospects.

Inactive Publication Date: 2014-10-29
HARBIN NORMAL UNIVERSITY
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The first chloroplast iron transport gene, PIC1, was first discovered in Arabidopsis and has not been reported in other species

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chloroplast iron transporter gene NtPIC1 and application thereof
  • Chloroplast iron transporter gene NtPIC1 and application thereof
  • Chloroplast iron transporter gene NtPIC1 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1. A full-length cDNA clone of tobacco chloroplast iron transport gene NtPIC1.

[0024] Search the tobacco EST sequence from the NCBI database (http: / / www.ncbi.nlm.nih.gov / ) and save it, use the Arabidopsis thaliana AtPIC1 sequence known in the database to edit the preserved tobacco EST sequence in the BioEdit software Text file carries out Local Blast, thus just obtained PIC1 gene EST sequence in tobacco.Utilize this sequence design primer, and primer is:

[0025] NtPIC1-F1: 5'-CGAACAAAACTAGCTATGCAAAC-3';

[0026] NtPIC1-R1: 5'-GACTCCCAATCACTTCATGC-3'.

[0027] The specific process is as follows:

[0028] RNA extraction: TRIZOL kit was used to extract RNA from tobacco (Nicotiana tabacum cv. SR-1) young leaves, reverse-transcribed it into cDNA, and amplified the full-length sequence of NtPIC1 by RT-PCR using this cDNA as a template.

[0029] RT-PCR reaction: KOD-plus DNA polymerase (Toyobo) was used for RT-PCR reaction, reaction program: 94°C pre-denaturation...

Embodiment 2

[0031] Example 2. Subcellular localization of tobacco chloroplast iron transport gene NtPIC1.

[0032] 1. Carrier Construction

[0033] Firstly, the sequence containing the full-length coding region of NtPIC1 gene (without terminator) was obtained by PCR, and the primers used contained BamHI and SacI restriction sites:

[0034] NtPIC1-BamHI: CGCGGATCCATGCAAACTCTACTTCTTG;

[0035] NtPIC1-SacI-1: CGAGCTCTGCAATCCTTGGTAC.

[0036] Digest the PCR product with SacI, and recover the fragment for smoothing: DNA 21 μL, KOD 1.5 μL, 10×Blunting Buffer 4 μL, H 2 O 3.5 μL. Smoothing reaction conditions: keep warm at 72°C for 5 minutes, and immediately cool at 4°C to stop the smoothing reaction. Phenol chloroform recovered smooth product. Then digest with BamHI, identify by 1% agarose gel electrophoresis, and recover the digested product; pBI221 (Biovector) vector is first digested with SmaI to produce blunt ends, and recover the digested product with phenol chloroform; then digest with ...

Embodiment 3

[0046] Example 3. Functional analysis of tobacco chloroplast iron transport gene NtPIC1.

[0047] 1. Construction of yeast expression vector

[0048] Use the following pair of primers to introduce BamHI and SacI restriction sites at the 5' and 3' ends of NtPIC1 respectively:

[0049] NtPIC1-BamHI: CGCGGATCCATGCAAACTCTACTTCTTG;

[0050] NtPIC1-SacI-2: CGAGCTCTCATGCAATCCTTGGTAC.

[0051] Digest the PCR product with SacI, and recover the fragment for smoothing: DNA 21 μL, KOD 1.5 μL, 10×Blunting Buffer 4 μL, H 2 O 3.5 μL. Smoothing reaction conditions: keep warm at 72°C for 5 minutes, and immediately cool at 4°C to stop the smoothing reaction. Phenol chloroform recovered smooth product. Re-digestion with BamHI, the obtained PCR product was identified by 1% gel electrophoresis, and the gel was recovered. Yeast expression vector pYES2.0 (purchased from Invitrogen) was first digested with NotI, smoothed (same as above), then digested with BamHI, and the digested product was re...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a tobacco (Nicotianatabacumcv.SR-1) chloroplast iron transporter gene NtPIC1 and application of encoding protein of the tobacco (Nicotianatabacumcv.SR-1) chloroplast iron transporter gene NtPIC1 in chloroplast iron transport. A nucleotide sequence of the gene is shown in a sequence table SEQIDNO: 1; a corresponding amino acid sequence is shown in a sequence table SEQIDNO: 2; the gene comprises 849bp of open reading frames; 282 amino acids are encoded; the predicted molecular weight is 29.7kDa. The accession number of the nucleotide sequence of the open reading frames on GeneBank is KF640606. By virtue of positioning analysis of GFP fusion protein cells, NtPIC1 protein is positioned on a chloroplast membrane. Proven by a yeast function complementary experiment, expression of the gene in a yeast can be used for effectively transporting iron ions. According to the tobacco (Nicotianatabacumcv.SR-1) chloroplast iron transporter gene NtPIC1 disclosed by the invention, the gene NtPIC1 is introduced into tobaccos so as to obtain transgenic tobaccos with high iron content in the chloroplast; a research result shows that the NtPIC1 gene is involved in the chloroplast iron transport and the chloroplast development process.

Description

technical field [0001] The invention relates to the cloning of tobacco chloroplast iron transport gene NtPIC1 and its application in tobacco chloroplast iron transport, belonging to the field of plant genetic engineering. Background technique [0002] Iron is a trace element necessary for the normal life activities of plants, ranking first among the essential trace elements of plants. Iron participates in a variety of metabolic processes of life activities, including photosynthesis, respiration, and chlorophyll synthesis, and is an important component of heme and iron-sulfur protein. Iron ions have active divalent and trivalent changes and are an essential component of the intracellular electron transport chain. [0003] Despite the high abundance of Fe in the Earth's crust, Fe available in soil 2+ Due to the influence of the pH value of the soil solution and the partial pressure of oxygen, insoluble Fe will form 3+ , thereby limiting the availability of iron in soils and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C12N15/82C12N15/81C12N15/11C07K14/415A01H5/00
Inventor郭长虹龚勋于典司
OwnerHARBIN NORMAL UNIVERSITY