Engineering bacteria based on nitrite reductase and implementation method of engineering bacteria

A technology of nitrite and reductase, which is applied in the field of genes and engineering strains in the field of biogenetic engineering technology, can solve the problems of low expression level and inability to meet environmental repair, and achieve the effect of maintaining protein activity and ensuring protein purity

Inactive Publication Date: 2014-11-19
SHANGHAI JIAO TONG UNIV
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Generally speaking, nitrite reductase is mostly expressed intracellularly in organisms and the expression level is very low, which cannot meet the needs of environmental restoration

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineering bacteria based on nitrite reductase and implementation method of engineering bacteria
  • Engineering bacteria based on nitrite reductase and implementation method of engineering bacteria
  • Engineering bacteria based on nitrite reductase and implementation method of engineering bacteria

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] In this example, Streptomyces griseorubens was isolated from rotten straw collected in Pujiang Town, Shanghai, and the deposit number is CGMCC No.5706. The strains were inoculated into LB liquid medium and cultured at 32°C for 48h.

[0027] The components of the above LB liquid medium are: peptone 10.0g / L, yeast extract 5.0g / L, NaCl 10.0g / L, pH 6.8-7.2. Add 15.0-20.0g / L agar to the liquid medium to obtain LB solid medium.

[0028] 1) Genomic DNA extraction of Streptomyces griseorubens: 2.0 mL of bacterial liquid was collected and centrifuged at 12000 rpm for 2 min. Discard the supernatant, collect the cell pellet, add 180 μL lysozyme (20 mg / mL) and 20 μL EDTA solution (0.5M, pH 8.0), treat at 37°C for 45 min, add 4 μL RNase A (100 mg / mL), shake and mix for 15 s, Place at room temperature for 5 minutes, then complete the remaining operations according to the instructions of the bacterial DNA extraction kit (TIANGEN) to obtain high-purity genomic DNA. The quality of ge...

Embodiment 2

[0051] Construction of nitrite reductase expression vector

[0052] 1) According to the nitrite reductase sequence, design a primer containing an enzyme cleavage site, and the sequence is as follows:

[0053] NC-Nco I-F: ACCATGGTGCCCCACGGACACCTCGACCATCGT

[0054] NC‐EcoR I‐R: GGAATTCTCA ATGATGATGATGATGATG TCGCTGTGCGCTTCCTT

[0055] ND-Nde I-F: GTACATATGACCCTGGCACTCGAGACGACCACC

[0056] ND‐EcoR V‐R:CGATATCTCA ATGATGATGATGATGATG CGCCGCCTTCACCTCGT

[0057] 2) Using the genomic DNA of Streptomyces griseorubens as a template, PCR amplification was performed with primers containing Nco I and EcoR I restriction sites to obtain the nitrite reductase large subunit gene sequence, using DNA A-Tailing Add A to Kit and connect to T-Vector PMD TM 19-T (TaKaRa), and the ligation product was transformed into DH5α E. coli. Positive clones were selected, and the plasmids were extracted and sequenced by shaking bacteria. If correct, Nco I and EcoR I were double digested (37°C) to recover...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to engineering bacteria based on nitrite reductase and an implementation method of the engineering bacteria in the technical field of genetic engineering. The method comprises the following steps: by taking streptomyces griseorubens genome DNA as a template, performing PCR amplification with a primer containing enzyme cutting sites to sequentially obtain nucleotide sequences for encoding nitrite reductase large-subunits and nitrite reductase small subunits; sequentially connecting the gene sequences obtained by amplification to a coexpression vector pETDuet-1, and finally obtaining a recombinant coexpression vector pETDuet-NC-ND; and transforming the nitrite reductase expression vector into an Escherichia coli expression strain. Aiming at the defects that the application range and effect are severely limited because most of the nitrite reductases are intracellular enzymes in a living body and the expression quantity is low in the prior art, the engineering bacteria can realize great in-vitro expression synthesis of the nitrite reductase by using genetic engineering means and has high significance for rapidly repairing secondary salinization soil and realizing precision agriculture.

Description

technical field [0001] The invention relates to a gene in the technical field of biological genetic engineering and an engineered strain thereof, in particular to a nitrite reductase-based engineered strain of Streptomyces griseus and a realization method thereof. Background technique [0002] From an environmental point of view, the accumulation of N elements can cause waste of fertilizers and affect crop growth and soil utilization. At the same time, it can cause agricultural non-point source pollution through farmland surface runoff and farmland leakage. From the perspective of food safety, when Excessive intake of nitrate by the human body, nitrate (NO) in the body 3 - ) is easily reduced to nitrite (NO 2 - ), nitrite can oxidize the oxygen-carrying methemoglobin in the cells to methemoglobin without oxygen-carrying capacity, causing tissue hypoxia. Not only that, the oxidized methemoglobin will also reduce the oxygen-carrying oxyhemoglobin The function of releasing ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/70C12N9/06C12R1/19C12R1/465
CPCY02A40/10
Inventor周培冯海玮支月娥唐冬孙玉静毛亮罗艳青卫星
OwnerSHANGHAI JIAO TONG UNIV