Engineering bacteria based on nitrite reductase and implementation method of engineering bacteria
A technology of nitrite and reductase, which is applied in the field of genes and engineering strains in the field of biogenetic engineering technology, can solve the problems of low expression level and inability to meet environmental repair, and achieve the effect of maintaining protein activity and ensuring protein purity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] In this example, Streptomyces griseorubens was isolated from rotten straw collected in Pujiang Town, Shanghai, and the deposit number is CGMCC No.5706. The strains were inoculated into LB liquid medium and cultured at 32°C for 48h.
[0027] The components of the above LB liquid medium are: peptone 10.0g / L, yeast extract 5.0g / L, NaCl 10.0g / L, pH 6.8-7.2. Add 15.0-20.0g / L agar to the liquid medium to obtain LB solid medium.
[0028] 1) Genomic DNA extraction of Streptomyces griseorubens: 2.0 mL of bacterial liquid was collected and centrifuged at 12000 rpm for 2 min. Discard the supernatant, collect the cell pellet, add 180 μL lysozyme (20 mg / mL) and 20 μL EDTA solution (0.5M, pH 8.0), treat at 37°C for 45 min, add 4 μL RNase A (100 mg / mL), shake and mix for 15 s, Place at room temperature for 5 minutes, then complete the remaining operations according to the instructions of the bacterial DNA extraction kit (TIANGEN) to obtain high-purity genomic DNA. The quality of ge...
Embodiment 2
[0051] Construction of nitrite reductase expression vector
[0052] 1) According to the nitrite reductase sequence, design a primer containing an enzyme cleavage site, and the sequence is as follows:
[0053] NC-Nco I-F: ACCATGGTGCCCCACGGACACCTCGACCATCGT
[0054] NC‐EcoR I‐R: GGAATTCTCA ATGATGATGATGATGATG TCGCTGTGCGCTTCCTT
[0055] ND-Nde I-F: GTACATATGACCCTGGCACTCGAGACGACCACC
[0056] ND‐EcoR V‐R:CGATATCTCA ATGATGATGATGATGATG CGCCGCCTTCACCTCGT
[0057] 2) Using the genomic DNA of Streptomyces griseorubens as a template, PCR amplification was performed with primers containing Nco I and EcoR I restriction sites to obtain the nitrite reductase large subunit gene sequence, using DNA A-Tailing Add A to Kit and connect to T-Vector PMD TM 19-T (TaKaRa), and the ligation product was transformed into DH5α E. coli. Positive clones were selected, and the plasmids were extracted and sequenced by shaking bacteria. If correct, Nco I and EcoR I were double digested (37°C) to recover...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
