Pseudorabies virus gene-deleted attenuated strain as well as preparation method and application thereof

A pseudorabies virus and attenuated strain technology, applied in the field of bioengineering, can solve the problem of poor protection effect of mutant strains

Active Publication Date: 2014-11-19
SHANGHAI VETERINARY RES INST CHINESE ACAD OF AGRI SCI
View PDF1 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The present invention aims to solve the technical problem of PRV mutant strains appearing in China at present, but the existing commercialized PRV vaccines have poor protection effect on the mutant strains, and it is urgent to develop new PRV vaccines, and provides a pseudorabies virus gene-deficient attenuated strain, the gene-deletion The attenuated strain has a good immune protection effect on PRV mutant strains. Piglets within 2 weeks of age do not appear clinical symptoms of PRV after inoculation, and have high safety. It is suitable as a vaccine candidate strain for the prevention and treatment of pseudorabies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pseudorabies virus gene-deleted attenuated strain as well as preparation method and application thereof
  • Pseudorabies virus gene-deleted attenuated strain as well as preparation method and application thereof
  • Pseudorabies virus gene-deleted attenuated strain as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Construction of embodiment 1 PRV JS-2012gI / gE gene deletion transfer vector pBIE-GFP

[0052] Through the PCR method, two fragments located at bases 121632 to 123031 and bases 124854 to 126372 in the PRV JS-2012 genome were amplified and used as the left and right recombination arms of homologous recombination. At the same time, cut out the CMV promoter-EGFP gene fragment from the pEGFP-C3 plasmid by endonuclease digestion, cut out the SV40polyA signal sequence fragment from the pEGFP-N1 plasmid, and combine the left recombinant arm-CMV promoter-EGFP gene -SV40polyA signal sequence-right recombination arm was sequentially assembled into the pBluescript SK(+) vector to obtain the recombination transfer vector pBIE-GFP. The specific construction process is as follows (see figure 1 ):

[0053] 1.1 Primer design

[0054] According to the whole genome sequence of PRV JS-2012 strain, 2 pairs of primers PRELF / PRELR and PRERF / PRERR (see Table 1) were designed with Oligo6.0 s...

Embodiment 2

[0078] Construction of embodiment 2 PRVJS-2012-△gI / gE-EGFP strain

[0079] The cells were infected with PRVJS-2012 and the total DNA was extracted, and the total DNA was co-transfected with pBIE-GFP to obtain the recombinant virus. After 6 rounds of plaque purification, the recombinant virus JS-2012-△gI / gE-EGFP with deletion of gI and gE genes and EGFP marker was obtained.

[0080] 2.1 Primer design

[0081] According to the whole genome sequence of PRVJS-2012 strain, two pairs of primers gIU / gID and gEU / gED were designed with Oligo6.0 software to amplify the full-length sequence of gI and gE of PRV JS-2012. PRV commonly used detection primers gBup / gBdown, and identification primers gEup / gEdown for distinguishing wild virus from vaccine virus are kept by our laboratory. The primer sequences are listed in Table 2.

[0082] Table 2 PRV detection primers

[0083]

[0084] 2.2 Extraction of PRV JS-2012 genome

[0085] Inoculate the PRV JS-2012 strain into confluent monolay...

Embodiment 3

[0092] Example 3 Deletion of PRVJS-2012-△gI / gE-EGFP virus marker gene

[0093] Referring to the ideas in Example 1, the Ase I restriction site at the end of the left recombination arm was replaced with Xba I. Put the left recombination arm into the pBRA plasmid constructed in 1.5 to form a new homologous recombination transfer vector pBIE (see Figure 13 ). The cells were infected with PRV JS-2012-△gI / gE-EGFP and the total DNA was extracted, and the total DNA was co-transfected with pBIE to obtain the recombinant virus. After three rounds of plaque purification, the recombinant virus PRV JS-2012-△gI / gE without EGFP marker was obtained.

[0094] 3.1 Primers

[0095] Since the experiment needs to replace the Ase I restriction site at the end of the left recombination arm with Xba I in Example 1, a downstream primer needs to be redesigned to replace the Ase I restriction site with Xba I. The sequence of the primer PRELR-X is: 5'TTCTAGAAACTAGGGTCCACGACGCGCAGGCTG3' (SEQ ID NO.2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a pseudorabies virus gene-deleted attenuated strain. The deleted gene sequences of the attenuated strain include a nucleotide sequence for coding No.198 to No.366 amino acids of gI protein of a pseudorabies virus and a nucleotide sequence for coding No.1 to No.404 amino acids of gE protein of the pseudorabies virus. The invention further discloses a preparation method and an application of the pseudorabies virus gene-deleted attenuated strain. The pseudorabies virus gene-deleted attenuated strain has a good immune protection effect on the pseudorabies virus and can be used as a vaccine candidate strain for preventing and treating pseudorabies.

Description

technical field [0001] The invention relates to the technical field of bioengineering, in particular to a pseudorabies virus gene-deleted attenuated strain and its preparation method and application. Background technique [0002] Pseudorabies is a severe infectious disease caused by pseudorabies virus (PRV), characterized by fever, itching, and encephalomyelitis. PRV can infect a variety of hosts, but pigs are the main natural host, reservoir and disseminator of the virus. Pigs of different ages can be infected, mainly causing abortion, stillbirth, mummified fetuses in pregnant sows, high mortality in suckling piglets, and infertility in breeding pigs. PRV belongs to the herpesviridae herpesvirus subfamily A, its genome is a linear double-stranded DNA, about 150kb in length, composed of a long unique region (UL), a short unique region (US) and repeat sequences on both sides of the US, encoding More than 70 kinds of proteins. Virions are composed of three layers: nucleocap...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N7/00C12N15/85A61K39/245A61P31/22C12Q1/70C12Q1/68G01N33/569C12R1/93
Inventor童光志童武郑浩刘飞梁超周艳君单同领于海姜一峰高飞
OwnerSHANGHAI VETERINARY RES INST CHINESE ACAD OF AGRI SCI