Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Three glufosinate-resistant rice cytoplasm type glutamine synthetase mutants

A technology of glutamine and mutants, applied in the direction of enzymes, the use of carriers to introduce foreign genetic materials, enzymes, etc., can solve the problems of lack of glyphosate decomposing enzymes and insufficient tolerance, and achieve improved screening efficiency, easy cultivation, and easy The effect of genetic manipulation

Inactive Publication Date: 2014-11-26
SHANGHAI ACAD OF AGRI SCI
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are no research reports or patents on the glutamine synthetase gene that is insensitive to glufosinate and its commercial application. It is speculated that the possible reason is the lack of glyphosate-decomposing enzymes in nature, and bar has a strong resistance to glufosinate. decomposition effect
Overexpression of wild-type glutamine synthetase in plants can only partially alleviate glufosinate damage, such as wild-type pea-derived GS Genetically transformed wheat, transgenic plants can alleviate the damage of glufosinate, but the degree of tolerance is not enough for commercial application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Three glufosinate-resistant rice cytoplasm type glutamine synthetase mutants
  • Three glufosinate-resistant rice cytoplasm type glutamine synthetase mutants
  • Three glufosinate-resistant rice cytoplasm type glutamine synthetase mutants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0021] 1. Construction of an expression plasmid containing a recombinant cytoplasmic rice glutamine synthetase gene

[0022] cytoplasmic rice glutamine synthetase gene OsGS1 The gene (GenBank Accession No. AB037595) was used as a template, and the wild cytoplasmic rice glutamine synthase gene was synthesized in Nanjing GenScript Biotechnology Co., Ltd. Bam H I and Sac After I double-digested, it was inserted into the Escherichia coli expression vector pYM4807 with the correct reading frame to obtain a plasmid containing the wild cytoplasmic rice glutamine synthetase gene, which was defined as pYM4807-OsGS1.

[0023] 2 DNA shuffling method to construct wild cytoplasmic rice glutamine synthetase gene OsGS1 Gene mutation library

[0024] 2.1 Construction of mutant library

[0025] 1) Gene amplification: According to the known pYM4807 vector sequence, use Primer 5.0 to design two primers, P1 (GAGACGGTCACAGCTTGTCTG) and P2 (ATGCCTGGCAGTTCCCTACTC) for PCR reaction. The reac...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Toleranceaaaaaaaaaa
Login to View More

Abstract

The invention relates to glutamine synthetases with substantially enhanced glufosinate resistance. The glutamine synthetases with substantially enhanced glufosinate resistance are mutants obtained through in vitro directed molecular evolution of wild rice cytoplasm type glutamine synthetase. The numbers, the amino acid sequences and corresponding amino acid mutation sites of the mutants are OsGS1m1, SEQIDNo2 and G245S / G318V; OsGS1m2, SEQIDNo4 and N54S / S115F / G245S; and OsGS1m3, SEQIDNo6 and V200A / T293A / R295K respectively. The glufosinate enzyme activity inhibition constants Ki of the mutants OsGS1m1, OsGS1m2 and OsGS1m3 are 43.7, 19 and 87.5 times higher than the resistance of the wild glutamine glutamine synthetase. Verification of the functions of the three mutation genes in Saccharomyces cerevisiae further proves that the expression in the three genes can improve the glufosinate tolerance of the Saccharomyces cerevisiae from 10mM to above 100mM. The expression mode of the above yeast is very similar to the expression mode of a plant, so the verification result of the functions in the yeast proves that the three mutants have a very good application potential in the cultivation of glufosinate-resistant plants.

Description

technical field [0001] The invention belongs to the field of biological technology, and specifically relates to a group of mutant genes obtained by artificially synthesizing wild-type rice glutamine synthetase through DNA shuffling (DNA shuffling) technology. resistance was significantly enhanced. The genes described in this invention can be used to construct expression vectors for transformed plants. Background technique [0002] Transgenic glufosinate-resistant crops are the second herbicide-resistant crops next to glyphosate-resistant crops. The commercialized glufosinate-resistant crops include corn, rapeseed, sugar beet, cotton, etc. Of the 4 million hectares of rapeseed planted in Canada in 2001, 80% were herbicide-resistant varieties, of which glyphosate-resistant rapeseed accounted for 47%, and glufosinate-resistant rapeseed accounted for l3%. The herbicidal principle of glufosinate is that it can inhibit glutamine synthetase (Glutamine synthetase, GS), so that amm...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/52C12N9/00C12N15/81C12N1/19C12R1/865
Inventor 赵伟姚泉洪彭日荷
Owner SHANGHAI ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com