Three glufosinate-resistant rice cytoplasm type glutamine synthetase mutants
A technology of glutamine and mutants, applied in the direction of enzymes, the use of carriers to introduce foreign genetic materials, enzymes, etc., can solve the problems of lack of glyphosate decomposing enzymes and insufficient tolerance, and achieve improved screening efficiency, easy cultivation, and easy The effect of genetic manipulation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0021] 1. Construction of an expression plasmid containing a recombinant cytoplasmic rice glutamine synthetase gene
[0022] cytoplasmic rice glutamine synthetase gene OsGS1 The gene (GenBank Accession No. AB037595) was used as a template, and the wild cytoplasmic rice glutamine synthase gene was synthesized in Nanjing GenScript Biotechnology Co., Ltd. Bam H I and Sac After I double-digested, it was inserted into the Escherichia coli expression vector pYM4807 with the correct reading frame to obtain a plasmid containing the wild cytoplasmic rice glutamine synthetase gene, which was defined as pYM4807-OsGS1.
[0023] 2 DNA shuffling method to construct wild cytoplasmic rice glutamine synthetase gene OsGS1 Gene mutation library
[0024] 2.1 Construction of mutant library
[0025] 1) Gene amplification: According to the known pYM4807 vector sequence, use Primer 5.0 to design two primers, P1 (GAGACGGTCACAGCTTGTCTG) and P2 (ATGCCTGGCAGTTCCCTACTC) for PCR reaction. The reac...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Tolerance | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 