Tyrosinase coding gene melC derived from streptomyces kathirae SC-1 and proteins of tyrosinase coding genes melC

A tyrosinase gene, tyrosinase technology, applied in genetic engineering, plant gene improvement, DNA/RNA fragments, etc., can solve the problems of expensive and large-scale production and application of melanin, cumbersome process and high cost

Inactive Publication Date: 2015-03-11
JIANGNAN UNIV
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the production of melanin is mainly the extraction of animals and plants and the use of chemical methods to produce tyrosine as raw materials. These two methods are high in cost and cumbersome in process, which limits the large-scale production and application of melanin due to its high price.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tyrosinase coding gene melC derived from streptomyces kathirae SC-1 and proteins of tyrosinase coding genes melC
  • Tyrosinase coding gene melC derived from streptomyces kathirae SC-1 and proteins of tyrosinase coding genes melC
  • Tyrosinase coding gene melC derived from streptomyces kathirae SC-1 and proteins of tyrosinase coding genes melC

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Embodiment 1: (1) Streptomyces kathirae SC-1 is inoculated in culture medium (g / L: glucose 1, peptone 10, NaCl 5, CaCl 2 0.1, pH 6.2) 36h, 8000g centrifugation to collect the fermentation broth to remove mycelia.

[0030] (2) Under the condition of ice bath, add ammonium sulfate to the fermentation broth until its saturation is 65% to precipitate tyrosinase protein, continue to stir the fermentation broth for 20 minutes, centrifuge at 12000g for 1 hour, discard the supernatant carefully, and collect the protein For precipitation, use Buffer A to resuspend the enzyme protein.

[0031] (3) The enzyme protein solution in step (2) is dialyzed to obtain a protein sample solution, passed through a Q Sephrose FF ion-exchange chromatography column, first eluted with Buffer A until no protein flows out, and then gradiently eluted with the eluent Buffer B, Obtain high-purity tyrosinase.

Embodiment 2

[0032] Embodiment 2: Use MS to identify and determine the partial amino acid sequence of purified tyrosinase, design primers according to the amino acid sequence obtained by MS, and clone a part of the tyrosinase coding gene, its main features are:

[0033] The genotype of the upstream primer is: TCCCCCTCGTTCCTGCCCTGGCACCG;

[0034] The genotype of the downstream primer is: GGTGCCGCCGAGGAAGTCGGGCGCCC;

[0035]The PCR amplification conditions of the gene encoding tyrosinase were: pre-denaturation at 94°C for 5 minutes; denaturation at 95°C for 45 seconds, annealing at 69°C for 30 seconds, extension at 72°C for 30 seconds, and 25 cycles of reaction;

[0036] After PCR amplification, use 0.8% agarose gel electrophoresis, Goldview staining, observe the results under ultraviolet light, connect the pMD-18T vector to transform Escherichia coli E.coli JM109 after gel recovery, and send it to Shanghai Bioengineering after screening on Amp plate The company performs sequencing. In NCB...

Embodiment 3

[0037] Embodiment 3: the partial gene sequence that embodiment 2 obtains, design primer, apply TAIL-PCR to amplify known gene fragment two-terminal sequence, its main feature is:

[0038] Use SP1-6 combined with AD primers to amplify the 3' end gene sequence of known gene fragments, and use SP7-12 combined with AD primers to amplify the 5' end gene sequences of known gene fragments;

[0039]

[0040] The first round of TAIL-PCR amplification conditions are: 94°C, 1min→97°C, 5min→{95°C, 30s, 67°C, 1min, 72°C, 2min30s}×5cycles→94°C, 30s, 30°C, 3min, ramp to72°C over 3min, 72°C, 2min30s→{94°C, 30s, 67°C, 1min, 72°C, 2min30s, 94°C, 30s, 67°C, 1min, 72°C, 2min30s, 94°C, 30s, 44°C, 1min, 72℃, 2min30s}×15cycles→store at 12℃;

[0041] The first-round TAIL-PCR product was diluted 40 times as the second-round TAIL-PCR template, and its amplification conditions were:

[0042] 94°C, 1min→{94°C, 30s, 67°C, 1min, 72°C, 2min30s, 94°C, 30s, 67°C, 1min, 72°C, 2min30s, 94°C, 30s, 44°C, 1mi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to tyrosinase coding gene melC derived from streptomyces kathirae SC-1 and proteins of the tyrosinase coding genes melC. Streptomyces kathirae SC-1 is a high-yielding melanin strain obtained through early screening in the laboratory and is now kept in China Center for Type Culture Collection (CCTCC) with the preservation number of CCTCC M 2012432. The process provided by the invention finally obtains a cloned 1899bp sequence which includes a 553 bp upstream open reading frame sequence and tyrosinase operon melC (including two coding genes melC1 and melC2). The melC1 gene product is tyrosinase metallochaperone and has the functions of activating tyrosine zymogen, transporting copper ions to tyrosinase, helping tyrosinase move outside the cell. By comparing the tyrosinase encoding gene provided by the invention with that reported at home and abroad, the highest similarity degree between both is only 75%, and by comparing the encoded amino acid sequence provided by the invention with that reported at home and abroad, the highest similarity degree between both is only 83%. The comparison results prove that the tyrosinase coding gene melC derived from streptomyces kathirae SC-1 is a novel tyrosinase.

Description

technical field [0001] The invention relates to cloning the tyrosinase encoding gene from Streptomyces kathirae SC-1, belonging to the technical field of genetic engineering. technical background [0002] With the increasing number of carcinogenic and disease-causing reports about artificial melanin, people are increasingly concerned about the harm caused by artificial pigments to the human body. There is growing concern about the biosafety of pigments. Natural melanin is a heterogeneous polyphenolic polymer, with tyrosine as a substrate, catalyzed by tyrosinase to generate L-dopa, dopa chromium, etc., and then through a series of non-enzyme-catalyzed oxidation reactions to finally generate melanin. Melanin widely exists in animals, plants and microorganisms, and is related to biological self-protection mechanisms. Studies have shown that natural melanin color has UV absorption, anti-oxidation, free radical scavenging, chelation of cations (such as toxic heavy metals), ne...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/53C12N9/02C12N15/11
Inventor饶志明郭静杨套伟徐美娟张显满在伟
OwnerJIANGNAN UNIV