Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of acid xylanase mutant and its application

A technology of xylanase mutation and xylanase, which is applied in the field of acid xylanase mutants, can solve the problem of less acid xylanase, and achieve strong heat resistance, high tolerance, and heat resistance sex-enhancing effect

Active Publication Date: 2017-07-18
QINGDAO VLAND BIOTECH GRP
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Most of the xylanases found so far have an optimal pH value in the range of 6-7, and there are relatively few reports on acid xylanases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of acid xylanase mutant and its application
  • A kind of acid xylanase mutant and its application
  • A kind of acid xylanase mutant and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] The amplification of embodiment 1 xylanase gene

[0026] According to the gene sequence in the public gene database, the codon of the synthetic gene was optimized and the acid xylanase gene XynH2 was artificially synthesized. Its nucleotide sequence is SEQ ID NO: 2, and its encoded amino acid sequence is SEQ ID NO: 1 .

[0027] The acid xylanase gene XynH2 fragment was cloned by PCR reaction, and the primers and reaction conditions were as follows:

[0028] Primer 1 (F): GCGCGAATTCTTTCCTTCTGAGTTGGCTCAA

[0029] Primer 2 (R): TAAAGCGGCCGCTTAAGAGACGGTAATAGTAGA

[0030] The reaction conditions were: denaturation at 94°C for 30s, renaturation at 56°C for 30s, extension at 72°C for 45s, and after 30 cycles, incubation at 72°C for 10 minutes. The results of agarose electrophoresis showed that the XynH2 gene was a 621bp fragment.

Embodiment 2

[0031] Construction and screening of embodiment 2 xylanase mutants

[0032] In order to improve the heat resistance of the above-mentioned xylanase XynH2, the applicant screened a large number of mutations of the enzyme by directed evolution technology.

[0033] Using the XynH2 gene as a template, use primers 1 and 2 to perform PCR amplification with the GeneMorph II Random Mutation PCR Kit (Stratagene), recover the PCR product from the gel, perform enzyme digestion with EcoRI and NotI, and then ligate it to the pET21a vector after the same enzyme digestion , transformed into Escherichia coli BL21(DE3), spread on LB+Amp plates, and culture them upside down at 37°C. After the transformants appeared, pick them one by one with a toothpick to a 96-well plate, and add 150ul of 0.1mM IPTG to each well. LB+Amp medium, cultivated at 37°C and 220rpm for about 6 hours, centrifuged to discard the supernatant, resuspended the bacteria with pH 5.5 buffer, and repeatedly freeze-thawed to br...

Embodiment 3

[0040] The construction of embodiment 3 Pichia pastoris engineering strain

[0041]The wild-type xylanase gene XynH2 and the xylanase mutant gene XynH2-1, XynH2-2, and XynH2-3 fragments cloned above are connected to the expression vector pPIC9K through the EcoR I and Not I sites respectively, The recombinant expression vectors pPIC9K-XynH2, pPIC9K-XynH2-1, pPIC9K-XynH2-2, pPIC9K-XynH2-3 were constructed.

[0042] The expression vector was linearized with Sal I, and the linearized fragment of the expression plasmid was transformed into Pichia pastoris GS115 by electroporation, and the recombinant strains of Pichia pastoris GS115 / pPIC9K-XynH2, GS115 / pPIC9K-XynH2-1, GS115 / pPIC9K-XynH2-1, GS115 / pPIC9K-XynH2-2, GS115 / pPIC9K-XynH2-3, and then screen multiple copies of positive transformants on YPD plates containing different concentrations of geneticin.

[0043] The screened positive transformants were named Pichia pastoris XynH2 (Pichia pastoris XynH2), Pichia pastoris XynH2-1 (Pi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention aims at providing an acidic xylanase mutant and an application thereof. Through screening of a plurality of mutants on xylanase of penicillium funiculosum, three mutation sites N104D, T128G and Y129Q can cause improvement of the heat resistance of the xylanase. The optimal reaction temperature of wild xylanase XynH2 provided by the invention is 50 DEG C; the optimal reaction temperatures of mutants XynH2-1 and XynH2-2 are 55 DEG C; the optimal reaction temperature of a mutant XynH2-3 can be 60 DEG C; under the condition of over 53 DEG C, the relative enzyme activity levels of the three mutants are significantly higher than those of the wild mutant; treatment is carried out at 65 DEG C for 5 minutes; the remaining enzymatic activity of the wild xylanase XynH2 only is 5%; and the remaining enzymatic activities of the xylanase mutants XynH2-1, XynH2-2 and XynH2-3 are respectively 20%, 35% and 46%, so that the heat resistance of the screened xylanase mutant is significantly improved.

Description

technical field [0001] The invention belongs to the technical field of functional gene modification, and specifically relates to an acid xylanase mutant and application thereof. [0002] technical background [0003] Xylan (xylan) is an important component of hemicellulose, which widely exists in nature and accounts for almost one-third of the renewable organic carbon content of the earth. It is the second most abundant hemicellulose in nature after cellulose Polysaccharides. In gymnosperms, it accounts for 7%-12% of dry matter weight, and in angiosperms, xylan accounts for 15%-30% of dry matter weight. However, xylan cannot be digested and absorbed in the digestive tract of animals, has a strong anti-nutritional effect, and will affect the absorption and utilization of other nutrients, thus greatly limiting xylan-rich feed (barley, wheat, rye, etc. )Applications. Xylanase refers to the general term of a group of enzymes that can specifically degrade hemicellulose xylan in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/42C12N15/56C12N15/81C12N1/19C12R1/84
CPCC12N9/248C12N15/81
Inventor 徐晓东肖志壮李冬冬王海
Owner QINGDAO VLAND BIOTECH GRP
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com