Swine fever virus detection method based on G-quadruplex fluorescence characteristic and kit
A technology of swine fever virus and fluorescence characteristics, which is applied in the field of genetic engineering, can solve the problems of high requirements for operators, expensive reagents, and obstacles to application, and achieve the effects of improving detection efficiency, easy operation, and accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0028] The test kit for swine fever virus detection based on G-quadruplex fluorescent properties, which consists of:
[0029] (1) NASBA reaction buffer includes: 40mM Tris-HCl (PH8.0); 70mM KCl; 20mM MgCl2; 1mM deoxyribonucleoside triphosphates (dNTPs); 1mM ribonucleoside triphosphates (NTPs); Sugar Alcohol; 10% Dimethyl Sulfoxide (DMSO).
[0030](2) NASBA forward primer and reverse primer include, 0.5 μM forward primer (E2P7f): ACTATGAGCCCAGGGACAGCTACTT; 0.5 μM reverse primer (E2P7T7r): GTCGACTAATACGACTCACTATAGGGTTCCCTATCAACACTACCTCACCC T.
[0031] (3) NASBA enzyme reaction solution includes: T7 RNA polymerase 60U; AMV reverse transcriptase 5U; RNase (RNAseH) 0.1U, 2μg of BSA.
[0032] (4) The composition of G-quadruplex reaction buffer includes: 10 mM 4-hydroxyethylpiperazineethanesulfonic acid, 200 mM sodium chloride and 20 mM potassium chloride; 1 μM upstream probe and 1 μM downstream probe. Add sterile double distilled water to make up to 97 μl.
[0033] (5) The upstre...
Embodiment 2
[0040] The test kit for swine fever virus detection based on G-quadruplex fluorescent properties, which consists of:
[0041] (1) NASBA reaction buffer includes: 30mM Tris-HCl (PH8.0); 80mM KCl; 10mM MgCl2; 2mM deoxyribonucleoside triphosphates (dNTPs); 0.5mM ribonucleoside triphosphates (NTPs); 5mM disulfide Threitol; 20% Dimethyl Sulfoxide (DMSO).
[0042] (2) NASBA forward primer and reverse primer include, 0.5 μM forward primer (E2P7f): ACTATGAGCCCAGGGACAGCTACTT; 0.5 μM reverse primer (E2P7T7r): GTCGACTAATACGACTCACTATAGGGTTCCCTATCAACACTACCTCACCC T.
[0043] (3) NASBA enzyme reaction solution includes: T7 RNA polymerase 40U; AMV reverse transcriptase 2U; RNase (RNAseH) 0.15U, 5μg of BSA.
[0044] (4) The composition of G-quadruplex reaction buffer includes: 10mM 4-hydroxyethylpiperazineethanesulfonic acid, 200mM sodium chloride and 20mM potassium chloride; upstream probe 2μM and downstream probe 2μM, Add sterile double distilled water to make up to 97μl;
[0045] (5) The...
Embodiment 3
[0052] The test kit for swine fever virus detection based on G-quadruplex fluorescent properties, which consists of:
[0053] (1) NASBA reaction buffer includes: 60mM Tris-HCl (PH8.0); 60mM KCl; 30mM MgCl2; 0.5mM deoxyribonucleoside triphosphates (dNTPs); 2mM ribonucleoside triphosphates (NTPs); 20mM disulfide Threitol; 5% Dimethyl Sulfoxide (DMSO).
[0054] (2) NASBA forward primer and reverse primer include, 1 μM forward primer (E2P7f): ACTATGAGCCCAGGGACAGCTACTT; 1 μM reverse primer (E2P7T7r): GTCGACTAATACGACTCACTATAGGGTTCCCTATCAACACTACCTCACCC T.
[0055] (3) NASBA enzyme reaction solution includes: T7 RNA polymerase 60U; AMV reverse transcriptase 5U; RNase (RNAseH) 0.05U, 0.5μg of BSA.
[0056] (4) The composition of G-quadruplex reaction buffer includes: 10mM 4-hydroxyethylpiperazineethanesulfonic acid, 200mM sodium chloride and 20mM potassium chloride; upstream probe 0.5μM and downstream probe 0.2 μM. Add sterile double distilled water to make up to 97 μl.
[0057] (5...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com