Thioether monooxygenase PMO-3546 and application thereof

A thioether monooxygenase and protein technology, which is applied in the fields of biocatalysis, biosynthesis and molecular biology, can solve the shortage of high enantioselective thioether monooxygenase, which cannot meet the needs of green industrial production and low catalytic efficiency And other issues

Active Publication Date: 2015-06-03
ZUNYI MEDICAL UNIVERSITY
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, existing studies have shown that thioether monooxygenases with high activity, high enantioselectivity and high substrate tolerance are still very scarce
No matter using isolated monooxygenase, thioether monooxygenase-producing strains, or recombinantly expressed thioether monooxygenase genetically engineered bacteria, the catalytic efficiency is very low, which cannot meet the needs of green industrial production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Thioether monooxygenase PMO-3546 and application thereof
  • Thioether monooxygenase PMO-3546 and application thereof
  • Thioether monooxygenase PMO-3546 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1. Acquisition of gene encoding thioether monooxygenase

[0041] By analyzing the genome sequence of Pseudomonas strain, a monooxygenase sequence with a length of 486 bp was determined, a pair of specific primers were designed and amplified by PCR technology, and the full-length coding frame sequence of the gene was finally obtained. The specific method is as follows: using the extracted genomic DNA as a template, use primers F: 5'- CTGCGGATCCATGATCGACGCAACCGTCT -3' and R: 5'- AACCAAGCTTGGCA

[0042]AAGGCCGGCAG-3' was PCR amplified. The PCR reaction system is as follows: 12.5 ul of 2×TaqPCR Master Mix, 1 ul of genomic DNA, 0.5 ul of upstream and downstream primers, and 10.5 ul of ddH2O. PCR reaction conditions: 95°C for 10 min; cycle of 98°C for 10 s, 57°C for 30 s, 72°C for 90 s; extension at 72°C for 10 min, 30 cycles. The PCR product was electrophoresed on a 1% agarose gel to verify whether a fragment conforming to the size of the target gene was obtaine...

Embodiment 2

[0043] Example 2. Construction of thioether monooxygenase gene expression vector

[0044] Using the pET32a(+) vector (purchased from Novagen) as the backbone, the monooxygenase gene was constructed pmo-3546 prokaryotic expression vector. The specific method is as follows: Use the DNA gel recovery kit to recover pmo-3546 PCR products, with restriction enzymes Bam h and Hin d The PCR product and the vector pET32a(+) were double digested, and the recovered target fragment and vector were digested. After ligation with T4 DNA ligase at 16 °C for 4 h, the ligation product was transformed into Escherichia coli DH5α. After culturing overnight, pick out the grown monoclonal colony and shake the bacteria and extract the plasmid, use Bam h and Hin d Double-enzyme digestion detection of recombinant plasmids. Select the positive recombinant plasmid pET32a- pmo-3546 DNA sequencing is performed to ensure the sequence is accurate. Finally, the positive recombinant ...

Embodiment 3

[0045] Example 3. Recombinant expression and detection of thioether monooxygenase protein

[0046] Will be stored in glycerol containing pET32a- pmo-3546 After activation of the genetically engineered bacteria BL21(DE3) with the plasmid, pick a single colony in 3 ml of liquid LB medium containing the corresponding antibiotics, culture with shaking at 37 °C for 12 h, and transfer to a fresh medium containing 1% of the inoculum the next day. In 50 mL LB liquid medium of antibiotics, shake culture at 37°C 250 rpm with OD600 of 0.6 (about 3h), add IPTG with a final concentration of 0.5 mM, and induce culture at 25°C 160 rpm for 8h. After induction, collect the cells by centrifugation at 8,000 rpm / min for 5 min, resuspend the cells in PBS buffer, break up the cells by ultrasonic, and centrifuge at 15,000 rpm for 5 min to remove cell debris, take the supernatant and mix with 5x loading buffer, and place in SDS-PAGE electrophoresis analysis was performed after heating in a consta...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention cloning expresses and discloses a thioether monooxygenase PMO-3546 and an application thereof. The size of the zymoprotein is 18 kD and the amino acid sequence is shown in SEQ ID NO.1, and the corresponding coding gene length is 486 bp and the nucleotide sequence is shown in SEQ ID NO.2. The zymoprotein can effectively catalyze the thioether substrate to generate the sulfoxide after recombinant expression, and is high in conversion efficiency and stereoisomerism enantioselectivity and can be used for biosynthesizing the chiral sulfoxide medicine.

Description

technical field [0001] The invention relates to the fields of biocatalysis, biosynthesis and molecular biology. Specifically, the present invention relates to the synthesis of chiral drugs using monooxygenase genes in the fields of biocatalysis and biosynthesis. The invention also relates to a method for monooxygenase gene cloning and recombinant protein expression. Background technique [0002] Chiral sulfoxides are important chiral intermediates and adjuvants, chiral ligands, catalysts and chiral drugs, which can be used in the synthesis of important chiral amines and chiral amino acids and various natural products. In addition, drugs for the treatment of gastric ulcer, duodenal ulcer, and reflux esophagitis, such as omeprazole, lansoprazole, and rabeprazole, all contain chiral sulfoxide active groups. At present, except for some transition metal catalysts such as titanium and vanadium that can effectively catalyze the asymmetric oxidation reaction of thioether substrate...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/02C12N15/53C12N1/21C12N15/78C12P11/00C12R1/38
Inventor陈永正杨加伟张红燕崔宝东韩文勇
OwnerZUNYI MEDICAL UNIVERSITY