Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for improving degradation of lignocellulose and for producing cellulase and hemicellulase

A cellulose degradation and hemicellulase technology, applied in the field of genetic engineering

Active Publication Date: 2015-08-19
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the study of improving the efficiency of biomass degradation, traditional mutagenesis techniques have made significant progress, with limited room for improvement

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving degradation of lignocellulose and for producing cellulase and hemicellulase
  • Method for improving degradation of lignocellulose and for producing cellulase and hemicellulase
  • Method for improving degradation of lignocellulose and for producing cellulase and hemicellulase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0075] The acquisition of embodiment 1 engineering bacteria

[0076] Transcription factors in the starting strain can be knocked out using conventional techniques.

[0077] Taking the originating strain of N. crassa (FGSC2489) (purchased from FGSC) as an example, according to the principle of homologous recombination, the entire open reading frame (open reading frame, ORF).

[0078] 1) Design homology arm-specific primers

[0079] Upstream homology arm-specific primers:

[0080] NCU05064-5f: GTAACGCCAGGGTTTTCCCAGTCACGACGGACTTGACTTGAGTGACAGG (SEQ ID NO.: 11);

[0081] NCU05064-5r:ATCCACTTAACGTTACTGAAATCTCCAACGTTAGAAGCAGGAAGGAAGG (SEQ ID NO.: 12)

[0082] Downstream homology arm-specific primers:

[0083] NCU05064-3f: CTCCTTCAATATCATTCTTCTGTCTCCGACTACTGCGAGGAAGATCAAGG (SEQ ID NO.: 13);

[0084] NCU05064-3r: GCGGATAACAATTTCACACAGGAAACAGCCCTACCTACCTATCCAGACG (SEQ ID NO.: 14)

[0085] Amplify the upstream and downstream homology arms of the target gene; then use primers to a...

Embodiment 2

[0097] The verification of embodiment 2 engineering bacteria

[0098] Genomic DNA extraction: Genomic DNA was extracted from spores by the phenol-chloroform method

[0099] 1) RCR uses a 25 μl system, including 12.5 μl DreamTaq PCR Master Mix 12.5 μl, 9.5 μl water (nuclease-free), 1 μl upstream and downstream primers, and 1 μl genomic DNA.

[0100] 2) Perform PCR amplification under the following conditions: pre-denaturation at 95°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at 52°C for 45 seconds, extension at 72°C for 2 minutes, 34 cycles under the same conditions, and finally annealing at 72°C for 10 minutes.

[0101] 3) 110V voltage, 1% agarose gel electrophoresis for 30 minutes, and the gene amplification bands were seen under the gel imaging system (see Figure 7 ).

[0102] 4) Bacteria preservation: After preservation with 30% glycerin, store in a -80°C refrigerator.

Embodiment 3

[0103] Embodiment 3 mutant produces cellulase, hemicellulase experiment

[0104] Transcription factor engineering bacteria and wild-type Neurospora crassa were cultured on 2% crystalline cellulose or 2% xylan medium for 7 days, respectively, and the culture supernatant was collected and centrifuged to conduct a series of validation experiments.

[0105] 3.1 Method:

[0106] 3.1.1 Enzyme activity assay

[0107] (1) Determination of endo-1,4-β-glucanase activity: dilute the crude enzyme solution with 0.1M sodium acetate buffer solution to an appropriate multiple, the final volume is 0.5mL, and put it in a water bath at 40°C Preheat, remove, add 0.5mL Megazyme AZO-CM-CELLULOSE substrate solution, mix well, incubate at 40°C for 10min, stop the reaction with 2.5mL precipitation solution, let stand at room temperature for 10min, mix well, centrifuge at 1000g for 10min, at 590nm wavelength Measure OD. The blank group used inactivated enzyme solution as a control.

[0108] (2) Det...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for improving fungal degradation of lignocellulose or for producing cellulase and hemicellulase, belonging to the field of gene engineering. According to the method, a microbial strain in which a part of bases of transcription factors are knocked or mutated or expression of the transcription factors is reduced is used to degrade lignocellulose or produce cellulase and hemicellulase, wherein the microbial strain is neurospora, aspergillus, trichoderma, penicillium, fusarium or sporotrichum, the transcription factors comprise NCU05064, NCU03699, NCU02576, NCU06186 and NCU08744, and any one of the transcription factors is knocked, or a part of the bases of the transcription factors are mutated, or expression of any of the transcription factors is reduced. According to the invention, starting strains are obtained by knocking microbial transcription factors, mutating a part of bases or reducing gene expression of the microbial transcription factors, and the strains are applied to degradation of lignocellulose or improvement of expression of cellulose and hemicellulase or the expression level of other proteins.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and relates to a method for improving fungal degradation of lignocellulose or producing cellulase and hemicellulase, involving five genes (five transcription factor genes are respectively NCU05064, NCU03699, NCU02576, NCU06186, and NCU08744 ). Background technique [0002] Cellulose is the most widespread and abundant carbohydrate in nature. With the rapid consumption of earth resources, environmental pollution and energy crisis, cellulose has become the focus of research as a renewable energy source with great potential and environmental friendliness. As the largest renewable resource on earth, the utilization efficiency of cellulose is far below the requirements of social development. If it can be efficiently converted into usable energy, food and chemical raw materials, it will definitely have a great impact on human society. play a key role in the healthy development of To utilize these ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/42C12N1/14C12N1/15C12N15/87C12P19/14C12R1/66C12R1/885C12R1/80C12R1/77C12R1/645
Inventor 田朝光林良才李金根齐西珍孙文良李慧燕马延和
Owner TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI