Cloning and application of peanut constitutive promoter

A constitutive promoter and promoter technology, applied in the fields of molecular genetics and plant transgenics, can solve problems such as gene silencing, biological insecurity, co-suppression, etc.

Inactive Publication Date: 2015-09-09
BIOTECH RES CENT SHANDONG ACADEMY OF AGRI SCI +1
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, the application of promoter sequences cloned from viruses in plant genetic engineering may have potential biological insecurity
Moreover, repeated use of the same constitutive promoter to drive the expression of two or more exogenous genes may lead to gene silencing or co-suppression

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cloning and application of peanut constitutive promoter
  • Cloning and application of peanut constitutive promoter
  • Cloning and application of peanut constitutive promoter

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1 Cloning of Peanut AhLEC1B Gene Promoter

[0021] 1.1 Extraction of peanut genomic DNA

[0022] Use the method provided by the plant DNA extraction kit (product of Beijing Tiangen Biochemical Technology Co., Ltd.) to extract the DNA of young peanut leaves, and dissolve it in an appropriate amount of TE (pH8.0) buffer;

[0023] 1.2 Cloning of peanut AhLEC1B gene promoter

[0024]2.5 μg of peanut genomic DNA was digested with DraI, EcoRV, PvuII, and StuI endonucleases, extracted and purified with phenol, and dissolved in 20 μl of TE (pH 7.5) buffer. Take 4 μl of digested complete DNA, connect to Adaptor according to the requirements of BD GenomeWalker Universal Kit (sequence: 5'GTAATACGACTCACTATAGGGCACGCGTGGTCGACGGCCCGGGCTGGT 3', as shown in Seq ID No:3), and construct 4 peanut genomic DNA libraries (LD, LE, LP, LS). According to the obtained genome sequence of the peanut AhLEC1B gene, two nested 3' end-specific primers LEC1BGSP2-1 (5'CCTTGTTCCCATGTAAAACCATGAA...

Embodiment 2

[0038] Construction and Transformation of Embodiment 2 Plant Expression Vector

[0039] 2.1 Fusion of peanut AhLEC1B gene promoter sequence and GUS reporter gene

[0040] Select pCAMBIA3301 as the plant expression vector, digest the cloning vector with the target fragment correctly sequenced, and recover the target fragment by electrophoresis and gel. At the same time, the expression vector was digested with restriction endonucleases HindⅢ and NcoI, and the vector fragment was recovered. The promoter fragment and the vector fragment were connected, and pCAMBIA3301-AhLEC1B promoter recombinant vectors containing promoters of different lengths were screened by plasmid restriction map identification. The specific process can refer to the attached Figure 4 :

[0041] 1. Use primers F1 and R1 with restriction sites to amplify the promoter segment of the peanut AhLEC1B gene, separate and recover the target fragment by gel electrophoresis, clone it into the pEASY-T3 vector, and s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to cloning and application of a peanut constitutive promoter, belonging to the technical field of biology. A constitutive promoter of peanut AhLEC1 gene is cloned from the peanut, and the gene sequence is disclosed as SEQ ID NO:1. The GUS histochemical stain proves that the drive gene of the promoter forms constitutive efficient expression in roots, stems, leaves, flowers, embryos and other organs of plants. On the basis of the function of the promoter, a plant expression vector of GUS report gene driven by the promoter is constructed and used for transforming Arabidopsis thaliana, which indicates that the promoter has similar drive effects on the GUS gene to CaMV35S. The promoter has moderate segment size, is convenient for construction, and is suitable for application in laboratories and industry.

Description

technical field [0001] The invention relates to the field of molecular genetics, in particular to the field of plant transgenic technology, in particular to the cloning and application of a new peanut constitutive promoter. Background technique [0002] The promoter is a DNA sequence located upstream of the 5' end of the structural gene, which can activate RNA polymerase to accurately combine with the template DNA and have the specificity of transcription initiation. The promoter determines the direction of transcription and the efficiency of transcription, and also plays a decisive role in the type of RNA polymerase used. It is the key to understanding the mechanism of gene expression and transcription regulation, and is the center of plant gene transcription regulation. According to the mode of action and function, promoters can be divided into constitutive promoters, tissue-specific promoters and inducible promoters. Currently, constitutive promoters are the earliest and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113
Inventor唐桂英单雷徐平丽柳展基
OwnerBIOTECH RES CENT SHANDONG ACADEMY OF AGRI SCI