Method for preparing Cas9 protein capable of being used for embryo injecting and knockout mice preparing
A technology of pet-28a-cas9 and protein, applied in peptide preparation methods, chemical instruments and methods, organic chemistry, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0061] Example 1 Construction of recombinant plasmid pET-28a-Cas9 and prokaryotic expression of Cas9 protein
[0062] 1. PCR amplification of Cas9 sequence
[0063] (1) Design primers
[0064] The upstream and downstream primers were designed according to the Cas9 sequence on the px330 plasmid, and the sequences are as follows:
[0065] Upstream primer (shown in SEQ ID NO.1):
[0066] AAAGCGGCCGCCATGGCCCCAAAGAAGAAGCGGAAG;
[0067] Downstream primer (shown in SEQ ID NO.2):
[0068] AAAGGCGCGCCACTTTTTTCTTTTTTGCCTGGCCGGCC.
[0069] (2) PCR amplification
[0070] Using the px330 plasmid as a template, using the above-mentioned upstream and downstream primers, the target fragment was amplified by PCR using high-fidelity DNA polymerase (phhusion DNA polymerase) at different annealing temperatures. The results are attached figure 1 As shown, the five-pointed star represents the PCR target band (about 4000bp).
[0071] 2. Construction of recombinant plasmid pET-28a-Cas9
...
Embodiment 2
[0094] Embodiment 2 Purification of Cas9 protein
[0095] 1. Purification of Cas9 protein
[0096] Centrifuge the bacteria solution after induction of expression, resuspend the bacteria in the lysis buffer (including 50mM Tris-HCl, pH8.0 300mM NaCl, 10% glycerol, 40mM imidazole), and combine with the equilibrated Ni Sepharose FF at 4°C For half an hour, wash away impurity proteins with a lysis buffer greater than 10 times the volume of the column bed, and elute with an elution buffer (including 50mM Tris-HCl, pH8.0 300mM NaCl, 10% glycerol, 250mM imidazole), and elute Afterwards, SDS-PAGE analysis was carried out to test and observe the results.
[0097] The resulting protein was diluted three-fold with 50 mM Tris-HCl pH 8.0 300 mM NaCl 10% glycerol and concentrated in 100 kDa ultrafiltration tubes. The concentrated protein was dialyzed against 50mM Tris-HCl pH8.0 300mM NaCl 10% glycerol solution with a 30kDa dialysis bag. After adding glycerol to a final concentration of...
Embodiment 3
[0103] Example 3 Activity detection of purified Cas9 protein
[0104] The activity of purified Cas9 was verified by in vitro and in vivo experiments, respectively.
[0105] 1. In vitro activity detection
[0106] In order to detect the activity of Cas9 protein, we first carried out in vitro activity detection. It is known that Cas9 protein can cut DNA after binding with sgRNA. We prepared BIE plasmid as a substrate for testing the activity of Cas9 protein, and selected a site on the BIE plasmid to design sgRNA. After the active Cas9 protein combined with sgRNA, it can be The targeted DNA is cleaved into two fragments to determine whether the Cas9 protein is active or not.
[0107] Specifically, 100ng of BIE plasmid linearized by NcoI, 20ng of B2 sgRNA, and 250ng of purified Cas9 protein were mixed in 1×NEB buffer with a final volume of 10μL, incubated at 37°C for 30min, and analyzed by electrophoresis in 1% agarose gel. In vitro activity of Cas9 protein. The results are ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap