Method for preparing Cas9 protein capable of being used for embryo injecting and knockout mice preparing

A technology of pet-28a-cas9 and protein, applied in peptide preparation methods, chemical instruments and methods, organic chemistry, etc.

Active Publication Date: 2015-10-07
GUANGZHOU MAGIGEN BIOTECH
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The technical problem to be solved in the present invention is to overcome the defects and technical deficiencies of the existing Cas9 protein preparation methods, provide a method for purifying the Cas9 protein with the His tag in one step, and ensure that the prepared Cas9 protein is safe in vivo or in vitro. Active and suitable for embryo injection to produce modified animals

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing Cas9 protein capable of being used for embryo injecting and knockout mice preparing
  • Method for preparing Cas9 protein capable of being used for embryo injecting and knockout mice preparing
  • Method for preparing Cas9 protein capable of being used for embryo injecting and knockout mice preparing

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Example 1 Construction of recombinant plasmid pET-28a-Cas9 and prokaryotic expression of Cas9 protein

[0062] 1. PCR amplification of Cas9 sequence

[0063] (1) Design primers

[0064] The upstream and downstream primers were designed according to the Cas9 sequence on the px330 plasmid, and the sequences are as follows:

[0065] Upstream primer (shown in SEQ ID NO.1):

[0066] AAAGCGGCCGCCATGGCCCCAAAGAAGAAGCGGAAG;

[0067] Downstream primer (shown in SEQ ID NO.2):

[0068] AAAGGCGCGCCACTTTTTTCTTTTTTGCCTGGCCGGCC.

[0069] (2) PCR amplification

[0070] Using the px330 plasmid as a template, using the above-mentioned upstream and downstream primers, the target fragment was amplified by PCR using high-fidelity DNA polymerase (phhusion DNA polymerase) at different annealing temperatures. The results are attached figure 1 As shown, the five-pointed star represents the PCR target band (about 4000bp).

[0071] 2. Construction of recombinant plasmid pET-28a-Cas9

...

Embodiment 2

[0094] Embodiment 2 Purification of Cas9 protein

[0095] 1. Purification of Cas9 protein

[0096] Centrifuge the bacteria solution after induction of expression, resuspend the bacteria in the lysis buffer (including 50mM Tris-HCl, pH8.0 300mM NaCl, 10% glycerol, 40mM imidazole), and combine with the equilibrated Ni Sepharose FF at 4°C For half an hour, wash away impurity proteins with a lysis buffer greater than 10 times the volume of the column bed, and elute with an elution buffer (including 50mM Tris-HCl, pH8.0 300mM NaCl, 10% glycerol, 250mM imidazole), and elute Afterwards, SDS-PAGE analysis was carried out to test and observe the results.

[0097] The resulting protein was diluted three-fold with 50 mM Tris-HCl pH 8.0 300 mM NaCl 10% glycerol and concentrated in 100 kDa ultrafiltration tubes. The concentrated protein was dialyzed against 50mM Tris-HCl pH8.0 300mM NaCl 10% glycerol solution with a 30kDa dialysis bag. After adding glycerol to a final concentration of...

Embodiment 3

[0103] Example 3 Activity detection of purified Cas9 protein

[0104] The activity of purified Cas9 was verified by in vitro and in vivo experiments, respectively.

[0105] 1. In vitro activity detection

[0106] In order to detect the activity of Cas9 protein, we first carried out in vitro activity detection. It is known that Cas9 protein can cut DNA after binding with sgRNA. We prepared BIE plasmid as a substrate for testing the activity of Cas9 protein, and selected a site on the BIE plasmid to design sgRNA. After the active Cas9 protein combined with sgRNA, it can be The targeted DNA is cleaved into two fragments to determine whether the Cas9 protein is active or not.

[0107] Specifically, 100ng of BIE plasmid linearized by NcoI, 20ng of B2 sgRNA, and 250ng of purified Cas9 protein were mixed in 1×NEB buffer with a final volume of 10μL, incubated at 37°C for 30min, and analyzed by electrophoresis in 1% agarose gel. In vitro activity of Cas9 protein. The results are ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for preparing Cas9 protein capable of being used for embryo injecting and knockout mice preparing. A Cas9 protein sequence is converted into pET28a-ccdB-CmR carrier and is then converted to a prokaryotic expression bacterial strain, a bacterial body is collected after inducible expression is carried out, and the purified Cas9 protein is obtained after affinity purification, concentration purification with an ultrafiltration pipe and dialysis; and the pET28a-ccdB-CmR carrier is characterized in that a prokaryotic expression carrier pET28a serves as a foundation, a NotI-ccdB-CmR-AscI sequence is inserted between an (i)Hind( / i)III enzyme cutting site and an (i)Xho( / i)I enzyme cutting site, and therefore the Cas9 protein is obtained. By means of the method, an efficient Cas9 protein prokaryotic expression system is constructed, in-vitro cutting experiments prove that the Cas9 protein obtained through expressions has the in-vitro activity, and peculiar in-vitro DNA cutting can be carried out; and embryo injecting experiments prove that the purified Cas9 protein has the in-vivo activity and can be used for preparing gene modification animals.

Description

Technical field [0001] The present invention belongs to the field of protein technology.More specifically, it involves a preparation method that can be used for embryo injection preparation and knockout mice. Background technique [0002] For the study of clinical diseases, it is difficult to achieve various control variables in clinical patients, or due to the large causes of some diseases, the progress of the disease, or the disease of the disease.All need to establish corresponding experimental animal models.In addition, when we want to study the physiological function of a gene in the biological body, we also need to establish a certain experimental animal model and examine the function of the gene from multiple aspects.Therefore, Genome Editing technology has a very important position in establishing animal disease models and research gene functions.CRISPR-Associated) system.Except for the first dependency reorganization editing, the remaining three gene editing systems can ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P21/02C07K1/34C07K1/22
Inventor黄军就陈昱僖松阳洲
OwnerGUANGZHOU MAGIGEN BIOTECH