Supercharge Your Innovation With Domain-Expert AI Agents!

Hybridized tRNA (transfer ribonucleic acid) and application thereof to glutathione peroxidase preparation

A technology of glutathione peroxide and hybridization, applied in the direction of DNA / RNA fragments, recombinant DNA technology, enzymes, etc., can solve the problems of cumbersome operation, lack of targeting, long cycle of simulated enzymes, etc., and achieve wide application Prospects, high-efficiency preparation methods, and the effect of facilitating gene manipulation

Active Publication Date: 2015-11-04
JILIN UNIV
View PDF6 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Chinese patent 94102481.4, 96112628.0, 99104234.4, 200810050556.6 discloses the preparation method of all kinds of selenium-containing abzymes is exactly to apply the chemical mutation (modification) method to introduce the catalytic group Sec of GPX in the antibody class template protein, has following shortcoming: (1) in In the preparation process, only the step of chemical mutation (modification) will lose 20-40% of the enzyme protein, resulting in a significant decline in the yield of the simulated enzyme; (2) the cycle of preparing the simulated enzyme is long, the operation is cumbersome, and the time is long; (3) In the process of chemical mutation, phenylmethylsulfonyl fluoride, acetonitrile, etc. need to be used, these substances are toxic substances; (4) lack of targeting, for large protein molecules, a chemical reaction is often introduced at different sites Multiple non-specific catalytic groups, so the introduction of catalytic groups by chemical mutation cannot achieve the specificity of gene mutation method
[0005] Chinese patent 200810050556.6 also discloses another preparation method of human single-chain selenium-containing abzyme is to use auxotrophic prokaryotic expression system (Escherichia coli) and gene mutation method to introduce catalytic groups, but it is limited to human single-chain selenium-containing Preparation of selenium abzymes, excluding glutathione peroxidase (GPX) mutants and other GPX mimetic enzymes
[0007] The methods disclosed in Chinese patents 201310302778.3 and 2013101428661 have made breakthroughs, but they can only be used to prepare various types of GPX mutants with high activity, and cannot be used to prepare natural GPX proteins

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Hybridized tRNA (transfer ribonucleic acid) and application thereof to glutathione peroxidase preparation
  • Hybridized tRNA (transfer ribonucleic acid) and application thereof to glutathione peroxidase preparation
  • Hybridized tRNA (transfer ribonucleic acid) and application thereof to glutathione peroxidase preparation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0077] Example 1: Preparation of genetically engineered human GPX1 protein with synthetic hybrid tRNA sequence 1 and target gene combined with UAG read-through prokaryotic expression system

[0078] According to the tRNA base sequence described in the sequence 1 (SEQ ID No: 1) of the present invention, artificially synthesized in a biological company with a DNA synthesizer can express the hybrid described in the sequence 1 (SEQ ID No: 1) in the UAG read-through engineering strain tRNA gene, ensure that the 5' end of the hybrid tRNA gene contains the lpp promoter sequence and the ClaI restriction site, and the 3' end contains the rrnc terminator sequence and the ClaI restriction site (the sequence is as follows)

[0079] CCATCGATCCCATCAAAAAATATTCTCAACATAAAAAACTTTGTGTAATAACTTGTAACGCTGAATTCGGAAGATGTGGCCGAGCGGTTGAAGGCACCGGTCCTAAAACCGGCGACCCGAAAGGGTTCGCAGGTTCGAATCCTGTCATCTTCCGCCAGGATCCTCTAGAGTCGACCTGCAGATCCTTAGCGAAAGCTAAGGATTTTTTTTATCGATGG;

[0080] After the gene of the hybrid tRN...

Embodiment 2-16

[0084]The synthetic hybrid tRNA sequence 2-16 and the target gene combined with UAG read-through prokaryotic expression system were used to prepare genetically engineered human GPX1 protein. The specific method is exactly the same as in Example 1 except that according to the tRNA base sequence described in the sequence 2-16 (SEQ ID No: 2-16) of the present invention, it can be artificially synthesized in a biological company with a DNA synthesizer in the UAG read-through engineering strain Express the gene of the hybrid tRNA described in sequence 2-16 (SEQ ID No:2-16), ensure that the 5' end of the hybrid tRNA gene contains the lpp promoter sequence and the ClaI restriction site, and the 3' end contains the rrnc terminator Sequence and ClaI restriction site, the synthetic specific gene sequence sequence is respectively:

Embodiment 2

[0085] The gene sequence that can express the tRNA base sequence described in SEQ ID No: 2 synthesized by embodiment 2 is:

[0086] CCATCGATCCCATCAAAAAATATTCTCAACATAAAAAACTTTGTGTAATAACTTGTAACGCTGAATTCGGAAGATGTGGCCGAGCGGTTGAAGGCACCGGTCCTAAAACCGGCGACCCGAAAGGGTTCGCAGGTTCGACTCCTGTCATCTTCCGCCAGGATCCTCTAGAGTCGACCTGCAGATCCTTAGCGAAAGCTAAGGATTTTTTTTATCGATGG;

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses hybridized tRNA (transfer ribonucleic acid) and application thereof to glutathione peroxidase preparation and belongs to the field of biotechnology. The hybridized tRNA relates to sequences SEQ ID No: 1-16, consists of 90 basic groups, and not only can serve as substrate tRNA for selenocysteine synthesis, but also can be recognized by autologous elongation factor EF-Tu of escherichia coli. A hybridized tRNA gene is obtained by a gene synthesis method, then a GPX (glutathione peroxidase) gene is synthetized or amplified, the hybridized tRNA gene and the GPX gene are assembled on a secretory prokaryotic expression vector capable of expressing the hybridized tRNA, a TAG engineering strain is transformed and subjected to induced expression in presence of sodium selenite, and a catalytic group Sec of the GPX is introduced into a substrate binding site of protein in a way that conventional amino acids enter a peptide chain, so that the protein is given with high GPX activity. The hybridized tRNA and application thereof to glutathione peroxidase preparation have the advantages that the method is simple, and zymoprotein is high in activity, yield and stability, so that the problems that natural GPX is limited in source and instable in property are solved.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a hybrid tRNA and its application in preparing high-activity selenium-containing glutathione peroxidase. Background technique [0002] The substrate of selenium-containing glutathione peroxidase (GPX) is glutathione (GSH), and the catalytic group is selenocysteine ​​(Sec). In organisms, GPX together with superoxide dismutase (SOD) and catalase (CAT) constitute the body's antioxidant defense system. GPX plays an important role in this system. It uses the substrate GSH as a reducing agent to decompose hydrogen peroxide and various hydroperoxides in the body, so it can remove reactive oxygen species (ROS) in the body and prevent lipid peroxidation. Treat various diseases caused by active oxygen, such as aging, ultraviolet radiation, cardiovascular and cerebrovascular diseases, diabetes, tumors, etc. Different from other antioxidant enzymes, GPX can not only scavenge ROS, b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12N9/08C12N15/70
Inventor 魏景艳樊振林宋健管徒晨
Owner JILIN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More