Hybridized tRNA (transfer ribonucleic acid) and application thereof to glutathione peroxidase preparation
A technology of glutathione peroxide and hybridization, applied in the direction of DNA / RNA fragments, recombinant DNA technology, enzymes, etc., can solve the problems of cumbersome operation, lack of targeting, long cycle of simulated enzymes, etc., and achieve wide application Prospects, high-efficiency preparation methods, and the effect of facilitating gene manipulation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0077] Example 1: Preparation of genetically engineered human GPX1 protein with synthetic hybrid tRNA sequence 1 and target gene combined with UAG read-through prokaryotic expression system
[0078] According to the tRNA base sequence described in the sequence 1 (SEQ ID No: 1) of the present invention, artificially synthesized in a biological company with a DNA synthesizer can express the hybrid described in the sequence 1 (SEQ ID No: 1) in the UAG read-through engineering strain tRNA gene, ensure that the 5' end of the hybrid tRNA gene contains the lpp promoter sequence and the ClaI restriction site, and the 3' end contains the rrnc terminator sequence and the ClaI restriction site (the sequence is as follows)
[0079] CCATCGATCCCATCAAAAAATATTCTCAACATAAAAAACTTTGTGTAATAACTTGTAACGCTGAATTCGGAAGATGTGGCCGAGCGGTTGAAGGCACCGGTCCTAAAACCGGCGACCCGAAAGGGTTCGCAGGTTCGAATCCTGTCATCTTCCGCCAGGATCCTCTAGAGTCGACCTGCAGATCCTTAGCGAAAGCTAAGGATTTTTTTTATCGATGG;
[0080] After the gene of the hybrid tRN...
Embodiment 2-16
[0084]The synthetic hybrid tRNA sequence 2-16 and the target gene combined with UAG read-through prokaryotic expression system were used to prepare genetically engineered human GPX1 protein. The specific method is exactly the same as in Example 1 except that according to the tRNA base sequence described in the sequence 2-16 (SEQ ID No: 2-16) of the present invention, it can be artificially synthesized in a biological company with a DNA synthesizer in the UAG read-through engineering strain Express the gene of the hybrid tRNA described in sequence 2-16 (SEQ ID No:2-16), ensure that the 5' end of the hybrid tRNA gene contains the lpp promoter sequence and the ClaI restriction site, and the 3' end contains the rrnc terminator Sequence and ClaI restriction site, the synthetic specific gene sequence sequence is respectively:
Embodiment 2
[0085] The gene sequence that can express the tRNA base sequence described in SEQ ID No: 2 synthesized by embodiment 2 is:
[0086] CCATCGATCCCATCAAAAAATATTCTCAACATAAAAAACTTTGTGTAATAACTTGTAACGCTGAATTCGGAAGATGTGGCCGAGCGGTTGAAGGCACCGGTCCTAAAACCGGCGACCCGAAAGGGTTCGCAGGTTCGACTCCTGTCATCTTCCGCCAGGATCCTCTAGAGTCGACCTGCAGATCCTTAGCGAAAGCTAAGGATTTTTTTTATCGATGG;
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap