Unlock instant, AI-driven research and patent intelligence for your innovation.

A cell-screening model for downregulators targeting fungal cell wall chitin synthase

A technology of chitin synthase and fungal cell wall, which is applied in the field of genetic engineering, can solve the problems of cross-resistance of drug compounds and limited specificity of drug screening targets, and achieve uniform screening results, high-throughput screening, and easy operation Effect

Active Publication Date: 2019-01-15
MEDICINE & BIOENG INST OF CHINESE ACAD OF MEDICAL SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the limited specificity of drug screening targets, most of the drug compounds screened in the research have the problem of cross-drug resistance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A cell-screening model for downregulators targeting fungal cell wall chitin synthase
  • A cell-screening model for downregulators targeting fungal cell wall chitin synthase
  • A cell-screening model for downregulators targeting fungal cell wall chitin synthase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] "Example 1" Construction of Ppic9kG-UMPRO-LUC recombinant plasmid

[0036] 1.1 Primer design

[0037] UMPRO-F: GAAGATCTTGTAGCATGTACCTTGGTCGAGCCA

[0038] UMPRO-R: CGAGCTCAGCAAGCGAAAAGCCTCCCATG

[0039] LUC-F: TACGTAATGGAAGATGCCAAAAACATTAAGA

[0040] LUC-R: ATAAGAATGCGGCCGCTAAACTATTTAGACGTTGATCCTGGCGCTG

[0041] 1.2 Obtaining the shuffled vector Ppic9KG

[0042] After the Ppic9K vector (purchased from Invitrogen) was digested with BgI II and SacI (purchased from Takara), the gel was run, and a fragment with a fragment length of about 9000 bp was purified to obtain a shuffled vector, which was named Ppic9KG;

[0043] 1.3 Acquisition of UMPRO sequence of UMcsh5 gene promoter

[0044] Using NCBI Genbank number NC_026483Ustilagomaydis521chromosome 6, the UMcsh5 gene pre-promoter region sequence is about 1500bp, and the primer primer5.0 primer design software is used to design the primers UMPRO-F and UMPRO-R of the UMPRO promoter, and the artificially synthesized promote...

Embodiment 2

[0049] Screening of the monoclonal cell line GS115-UMPRO-LUC stably expressing the UMPRO promoter.

[0050] 2.1 Electrotransformation of Pichia pastoris GS115

[0051] 2.1.1 Cultivate Pichia pastoris in a 50ml centrifuge tube containing 5ml YPD, overnight at 30°C;

[0052] 2.1.2 Take 0.1-0.5ml of the overnight culture, inoculate a 2L shake flask containing 500ml of fresh medium, and grow overnight until OD600=1.3-1.5;

[0053] 2.1.3 Collect the cells by centrifugation at 1500°C for 5 minutes at 4°C, and suspend the cells in 500ml pre-cooled sterile water;

[0054] 2.1.4 Centrifuge as above, suspend the cells with 250ml pre-cooled sterilized water;

[0055] 2.1.5 Centrifuge as above, suspend the cells with 20ml pre-cooled 1M sorbitol;

[0056] 2.1.6 Centrifuge as above, suspend the cells with 1ml pre-cooled 1M sorbitol, to a final volume of about 1.5ml;

[0057] 2.1.7 Mix 80ul of the above cells with 5-20ug of linearized DNA (dissolved in 5-10ulTE), and transfer to a pre-c...

Embodiment 3

[0065] Application of "Example 3" Drug Screening

[0066] The monoclonal cell line GS115-UMPRO-LUC was divided into 2×10 per well 4 Cells were plated in a 96-well plate, and candidate compounds F1-F10 (50ug / ml) (selected from a compound library constructed in the laboratory) were added. No candidate compound and YPD medium were used as positive and blank controls, respectively. Each group of experimental settings After 48 hours of action in three duplicate wells, centrifuge at 4000rpm for 30min, absorb 100ul of the supernatant and transfer to a new 96-well plate, add luciferase substrate (Bright-Glo TM Luciferase Assay System) 50ul / well, let stand for 1min before detection. The results showed that after adding compound F7 (phosphodiester derivatives), the GS115-UMPRO-LUC cell line produced the weakest fluorescence, indicating that F7 had the strongest inhibitory effect on UMPRO promoter activity, see image 3 .

[0067]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a target fungus cytoderm chitin synthetase decreasing agent high-throughput screening model, belonging to the field of genetic engineering, the model consists of a UMcsh5 gene promoter sequence UMPRO, a recombinant plasmid Ppic9KG-UMPRO-LUC, monoclonal cell strain GS115-UMPRO-LUC for stable expression of the UMPRO promoter, a screening reagent and a luciferase reporter gene detection system. The screening model has the advantages of simple and convenient operation, low cost, high flexibility, wide applicable range, high screening efficiency and the like and has great application potentiality.

Description

Technical field: [0001] The invention belongs to the field of genetic engineering and relates to a high-throughput drug cell screening model targeting fungal cell wall chitin synthase downregulator. Background technique: [0002] Chitin synthase is a key enzyme in chitin biosynthesis, and chitin synthase inhibitors produced by microorganisms can inhibit the activity of this enzyme and prevent chitin biosynthesis, thereby inhibiting the growth of fungi or preventing insects from Larvae and pupae moult to achieve insecticidal effect. Since mammals do not have a chitin metabolism system, screening chitin synthase inhibitors is expected to develop new antifungal agents and insecticides with low toxicity and harmlessness to humans and animals. [0003] Among various chitin synthases, CS3 (class IV) synthesizes chitin rings at the cell budding site at the beginning of the cell cycle; CS2 (class II) synthesizes chitin rings between mother cells and daughter cells at the end of mit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/80C12N15/65C12N1/19C12Q1/6897C12Q1/02C12R1/84
Inventor 杨兆勇张晓琳赵晨李亚东金媛媛白利平黄颖冯晓洲汪康游樊帅
Owner MEDICINE & BIOENG INST OF CHINESE ACAD OF MEDICAL SCI