Recombinant Escherichia coli and application thereof to fermentative production of 2[4Fe4S]ferredoxin
A technology of recombinant Escherichia coli and Escherichia coli, applied in the directions of fermentation, microorganism-based methods, bacteria, etc., can solve the problems of high protein price, low expression amount, low activity, etc., and achieve good application prospects, high expression amount, and cost saving Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1: Construction of recombinant Escherichia coli that highly expresses 2[4Fe4S]-type ferredoxin in C.pasteurianumDSM525
[0035] Take C.pasteurianumDSM525 cells, and extract genomic DNA from C.pasteurianumDSM525 cells according to the method recommended by the bacterial genomic DNA extraction kit. According to the known 2[4Fe4S] type ferredoxin gene sequence in the genome of Clostridium pasteurianum (C.pasteurianum) DSM525 as shown in SEQ ID NO.1, the primers were designed as follows:
[0036] F Primer: 5'GACGACGACAAGATGGCATATAAAATCGCTGATTCATGTG3'
[0037] R primer: 5'GAGGAGAAGCCCGGTTATTCTTGTACTGGTGCTCCAACTGGA3'
[0038] Using the extracted C. pasteurianum DSM525 genomic DNA as a template, KOD hot-start DNA polymerase was used for PCR amplification to obtain 2[4Fe4S]-type ferredoxin gene. The PCR reaction system is as follows:
[0039]
[0040] The PCR reaction conditions are:
[0041] 95℃5min
[0042] 95°C for 30s, 55°C for 30s, 72°C for 30s and 30 cycles ...
Embodiment 2
[0048] Embodiment 2: the application of recombinant escherichia coli highly expressed 2 [4Fe4S] ferredoxin
[0049] (1) Inoculate the recombinant Escherichia coli strain constructed in Example 1 into the TB medium containing antibiotics and iron-sulfur sources with an inoculum size of 1% by volume, and cultivate it at 37°C and 180rpm for 2 to 3 hours to OD 620nm is 0.6, the bacterial liquid is obtained;
[0050] Among them, the formula and final concentration of components of the above TB medium are: Tryptone12g / L, Yeastextract24g / L, Glycerol4ml / L, KH 2 PO 4 2.3g / L, K 2 HPO 4 12.5g / L;
[0051] The above-mentioned antibiotics are chloramphenicol with a final concentration of 25 μg / ml, tetracycline with a final concentration of 10 μg / ml, and carbenicillin with a final concentration of 25 μg / ml;
[0052] The formula and final concentration of the above-mentioned iron and sulfur sources are: ferric ammonium citrate 0.2-0.3g / L, L-cysteine 0.1-0.2g / L, ferric citrate 0.18-0.3g...
Embodiment 3
[0056] Example 3: Separation, purification and activity determination of 2[4Fe4S]ferredoxin.
[0057] The purification of protein was carried out in an anaerobic operation box, and all solutions used were degassed and anaerobic treated after boiling.
[0058] Prepare the buffer required for purification: buffer A: Tris-HCl100mM, NaCl150mM, DTT2mM, pH7.5; buffer B: sodium phosphate Tris-HCl100mM, NaCl150mM, DTT2mM, desthiobiotin2.5mM, pH7.5; buffer W: Sodium phosphate 50mM, pH7.0.
[0059] Acquisition of crude enzyme solution: resuspend the frozen cells prepared in Example 2 with buffer A containing 10% glycerol, and use an ultrasonic disruptor to disrupt the cells. The cell disruption procedure is: working time 6 seconds, intermittent time 6 seconds , power 39%, total crushing time is 50 minutes. After the crushing is completed, centrifuge at 12,000 rpm for 30 minutes, take the supernatant and filter it with a 0.22um pore size filter membrane, and place it on ice as a crude ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com