Gene Os02g0532500 and protein capable of improving rice blast resistance, and applications of the gene

A rice blast and resistance technology, applied in the field of crop genetics, can solve problems such as difficult and effective implementation, and achieve the effects of ensuring production safety, increasing expression levels, and enhancing rice blast resistance

Inactive Publication Date: 2016-04-20
RICE RES INST GUANGDONG ACADEMY OF AGRI SCI
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The selection of molecular markers is often affected by parental polymorphism and recombination, making it difficult to effectively carry out molecular breeding for rice blast resistance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene Os02g0532500 and protein capable of improving rice blast resistance, and applications of the gene
  • Gene Os02g0532500 and protein capable of improving rice blast resistance, and applications of the gene
  • Gene Os02g0532500 and protein capable of improving rice blast resistance, and applications of the gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Embodiment 1 Improving the gene of rice blast resistance and the construction of overexpression vector

[0023] (1), get the seedling leaf position of Sanhuangzhan No. 2 (SHZ-2) of rice blast high-resistant variety, use TriZolReagent (Invitrogen company, its article number is: 15596026) to extract leaf total RNA, adopt formaldehyde denaturing gel electrophoresis and The purity and quantity of total RNA were detected by ultraviolet spectrophotometer;

[0024] (2) Take 1 μg of total RNA for the initial reverse transcription reaction, the reverse transcriptase used is PrimeScript (TAKARA company), and the steps of the reverse transcription reaction refer to the instructions for use of the reverse transcriptase. Using the reverse transcription product as a template, primers: F, CCGGAATTCAGTGACAGAACGAGCGTAGAAT (SEQ ID No: 3); R, GGAAGATCTTCACTAACGGGGAGTAACCTAA (SEQ ID No: 4), were used for PCR amplification. The polymerase used in PCR was KODFX (Toyobo Company). The reactio...

Embodiment 2

[0027] Example 2 Os02g0532500 Gene Overexpression Effect Identification in Transgenic Plants

[0028] The overexpression vector was transformed into the normal japonica rice variety Nipponbare by the method of genetic transformation mediated by Agrobacterium EHA105. Transformed primary (T 0 Generation) Through PCR and quantitative PCR detection, positive transformed plants were identified from the DNA level and RNA level, proving that the target gene Os02g0532500 has been transformed into rice, and the expression of the target gene Os02g0532500 has been increased.

[0029] In a controlled greenhouse, the transgenic positive plants were selfed to obtain the first generation of homozygous positive transgenes (T 1 Generation) strains, each strain selects 10 plants that are detected as positive by PCR to breed, and obtains T 2 generation plant, T 2 The generation strains were then tested by PCR to find out the strains derived from different T 0 T 2 There were 3 homozygous lines...

Embodiment 3

[0037] Example 3 Identification of rice blast resistance in Os02g0532500 overexpression transgenic plants

[0038] 1. Leaf blast phenotype identification

[0039] 3 homozygous overexpression transgene T in embodiment 2 2 Seeds of generation strains (OX-2, OX-11, OX-15) and wild type rice were germinated at 32°C, and after 2 days, the young shoots were transferred to plastic trays filled with soil for sowing. Sow 30 seeds separately, one plastic tray contains 3 transgenic lines and wild-type lines, and 3 biological replicates. When the seedlings grew to the 3-leaf stage under natural conditions, the seedlings were transplanted into an artificial climate box for inoculation.

[0040] The artificial climate box was set as follows: temperature, 25°C; light, 16000 LUX; 12h day and night; humidity, 100%. The rice blast strain used was Nipponbare-sensitive GD08-T13. strains (at a concentration of 1x10 6 spores / ml) was sprayed on the leaves, cultivated in total darkness for the f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a gene Os02g0532500 and a protein which are capable of improving rice blast resistance, and applications of the gene. The gene has a nucleotide sequence shown as SEQ ID No:1. The Os02g0532500 which is a rice GLP gene is proved to be a functional gene for rice blast resistance for the first time. Cloning and biological function verification of the gene have great reference significance for molecular mechanism research of the rice blast resistance. The expression quantity of the Os02g0532500 is greatly increased after rice is transformed with a rice transformation overexpression vector over-expressing the Os02g0532500 gene, rice blast resistance of transformed plants is obviously improved along with the increased expression quantity, and growth states and agronomic traits of transgenic plants are hardly changed. An Os02g0532500 overexpression technique can be applied for genetic engineering breeding of rice, and can be applied to production practice to improve the rice blast resistance, thus ensuring rice production safety under weather conditions with frequent rice diseases at present.

Description

technical field [0001] The invention belongs to the technical field of crop genetics, and more specifically, the invention relates to a gene Os02g0532500 for improving resistance to rice blast, protein and application thereof. Background technique [0002] Rice blast caused by the fungus Magnaporthegrisea (Hebert) Barr is one of the most serious rice diseases in the world, and has a devastating impact on global rice cultivation. Rice blast may occur in all stages of rice growth, especially leaf blast and ear blast are the most harmful. The global annual output loss due to rice blast is 11-30%, the direct economic loss is about 5 billion US dollars, and the lost grain is enough to feed 60 million people. In my country, rice blast occurs wherever rice is cultivated. The northern and southern rice fields are affected to varying degrees every year, generally with a 10-20% reduction in production, and 40-50% in severe cases, and some fields even have no harvest. [0003] At pr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/53C12N9/02C12N15/82A01H5/00
Inventor 刘清朱小源刘斌张少红杨梯丰董景芳
Owner RICE RES INST GUANGDONG ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap