Application of OsRA1 (Oryza Sativa Root Agriculture 1) in improving root configuration and nutrient efficient breeding

A root structure and nutrient technology, applied in the field of plant genetic engineering, can solve the problems of affecting the gravitational response of roots, limited application potential, and it is difficult to improve rice root structure to improve nutrient utilization, and achieve great application potential , Improve the effect of nutrient utilization

Inactive Publication Date: 2016-05-04
ZHEJIANG UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, it has been reported that OsCRL1 (Inukai et al., 2005), OsCRL4 (Katomie et al., 2008) and OsCRL5 (Katomie et al., 2011) are mainly involved in regulating the growth and development of adventitious roots in rice, but the root gravitropism of mutants of these genes is also affected. influences
In addition, studies have shown that both OsDRO1 and OsGA2ox5 overexpressed transgenic plants in rice can enhance the gravitropic response of roots (Uga et al., 2013; Shanetal., 2014), and OsDRO1 overexpressed transgenic plants can increase rice yield under drought conditions , has a certain application value; while OsGA2ox5 is mainly involved in the gibberellin metabolism pathway, the overexpression of this gene will cause plant dwarfing, and its application potential is limited
In summary, the abnormal expression of genes that regulate the gravitropic response of rice roots has been reported in the literature, in addition to affecting the gravitropic response of the root, it also leads to the loss of other good traits
Therefore, it is difficult to achieve the purpose of improving rice root architecture and improving nutrient utilization efficiency through the regulation of these genes.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of OsRA1 (Oryza Sativa Root Agriculture 1) in improving root configuration and nutrient efficient breeding
  • Application of OsRA1 (Oryza Sativa Root Agriculture 1) in improving root configuration and nutrient efficient breeding
  • Application of OsRA1 (Oryza Sativa Root Agriculture 1) in improving root configuration and nutrient efficient breeding

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Embodiment 1, OsRA1 gene cloning and identification

[0066] In the early stage, our laboratory obtained a mutant osra1 (Oryza sativa root architecture 1) with altered root system structure by screening EMS mutagenized rice M2 seeds, see (Shietal,. 2009) for details.

[0067] Rice cultivation conditions:

[0068] Cultivation temperature: 30°C during the day; 22°C at night;

[0069] Cultivation time: 12h during the day; 12h at night;

[0070] Ambient humidity: relative humidity is 65-70%;

[0071] Lighting conditions: 350molphotonsm –2 the s –1 .

[0072] Preparation of rice nutrient solution:

[0073] The rice culture solution was prepared according to the standard nutrient solution formula of the International Rice Institute (Yoshida et al., 1976), and the formula was slightly changed (the iron salt was made of Fe 3+ adjusted to Fe 2+ ). The formula is as follows:

[0074]

[0075] When in use, add 12.5 mL each of stock solution I, II, III, IV, and VI to e...

Embodiment 2

[0077] Example 2, Construction of OsRA1 promoter fusion GUS reporter vector and GUS staining

[0078] In order to study the expression pattern of OsRA1 gene in different organs, the present invention connects the OsRA1 promoter to the GUS reporter gene (OsRA1p::GUS). Using wild-type genomic DNA as a template, the OsRA1 promoter fragment was amplified with OsRA1 promoter-specific primers, and the size of the target promoter fragment was 2950bp.

[0079] Upstream primer: CACCAAATTTGACCCTCTACCTTTTC

[0080] Downstream primer: CACACACACACTCTCTCTCTCTC.

[0081] Amplification of the target promoter fragment:

[0082] Use high-fidelity enzyme (KOD-plus) for PCR amplification, the number of cycles is controlled below 28 cycles, and the reaction system is as follows:

[0083]

[0084] PCR reaction cycle parameters:

[0085] Pre-denaturation at 98°C for 3min, denaturation at 98°C for 10s, annealing at 60°C for 30s, extension at 68°C for 3min, a total of 28 cycles, and finally 5mi...

Embodiment 3

[0102] Embodiment 3, rice transgenic

[0103] Preparation of rice mature embryo callus:

[0104] 1. After husking the mature rice seeds, select the plump, smooth and spot-free seeds and put them into a beaker, and disinfect them with 70% alcohol for 2 minutes;

[0105] 2. Pour off the alcohol, add 25% (v / v) NaClO solution for disinfection for 30 minutes;

[0106] 3. Pour off the NaClO solution, wash 5 times with sterile water, and soak in sterile water for 30 minutes for the last time;

[0107] 4. Pour off the sterile water, put the seeds on sterile filter paper to blot dry, put the seeds flat in the japonica rice mature embryo induction medium, and culture them in the dark at 28°C for 10 days;

[0108] 5. Open the petri dish on the ultra-clean workbench, remove the buds and endosperm with tweezers, and leave the embryogenic callus (light yellow, dense and irregular), transfer it to the japonica rice subculture medium, and culture it in the dark at 28°C for 5- 10 days.

[...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a rice OsRA1 (Oryza Sativa Root Agriculture 1) gene cloned by forward genetics, as well as transgenosis revertant and an RNAi technical test for indentifying the gene; the invention also relates to utilizing a gene product to regulate rice root configuration to improve nutrient use efficiency and yield of rice. In particular, the invention discloses the application of the gene OsRA1 in improving root configuration and nutrient efficient breeding, the nucleotide sequence of the gene OsRA1 is described as SEQ ID NO: 1. Through the application provided by the invention, gene engineering or cross choose breeding is used for regulating root growth angles and improving root configuration of plants, so as to improve absorption efficiency of the plants to soil nutrient, and finally increase the yield of crops.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering. Specifically, the present invention relates to a rice OsRA1 (OryzaSativaRootArchitecture1) gene cloned by a forward genetics approach, and the gene is identified through transgene reversion and RNAi technology experiments; it also relates to the use of the gene product to regulate the rice root system configuration so as to improve the nutrition of rice Utilization efficiency and yield. Background technique [0002] The root system is an important organ for plants to anchor and absorb water and nutrients from the soil. Good root architecture is the basis for efficient absorption of nutrients and water. According to the distribution of plant roots in the soil, they can be divided into shallow root system, intermediate root system and deep root system. In nutrient-stratified soils, shallow roots have more advantages in absorbing local nutrients (Gee et al., 2000). For example, phosphorus...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00
CPCC07K14/415C12N15/8218C12N15/8261
Inventor毛传澡李勇任美燕刘颖瑶曾鸣吴运荣胡晗
OwnerZHEJIANG UNIV