Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for detecting avian chlamydia psittaci by enzyme linked immunosorbent assay

An ELISA detection technology for Chlamydia psittaci, which is applied in the field of ELISA detection kits for Chlamydia psittaci, can solve the problems that the result judgment is greatly affected by subjective factors, prone to false positives, and cumbersome test operations, etc. Achieve good market prospects, reduce the influence of subjective factors, and have good sensitivity

Active Publication Date: 2016-05-25
CHINA AGRI UNIV
View PDF4 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The complement fixation test is cumbersome to operate, has low sensitivity, takes a long time to detect, and requires high professional knowledge, so it is subject to more restrictions in clinical application
[0008] The operation procedure of the indirect hemagglutination test method is simple and does not require special equipment, but the result judgment is greatly affected by subjective factors, and most of the coupled antigens are whole bacteria, which may have cross-reaction with some Gram-negative bacteria, and the results are prone to false positives
The colloidal gold test strip method is simple and easy to operate, but the detection sensitivity is low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting avian chlamydia psittaci by enzyme linked immunosorbent assay
  • Kit for detecting avian chlamydia psittaci by enzyme linked immunosorbent assay
  • Kit for detecting avian chlamydia psittaci by enzyme linked immunosorbent assay

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Example 1 Preparation of recombinant protein MOMP

[0061] 1. Extract the total DNA of Chlamydia psittaci 6BC strain (DNA extraction kit purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.)

[0062] 1) Take 100 μL of the purified product of Chlamydia psittaci 6BC strain, add 200 μL of buffer GA, shake and mix.

[0063] 2) Add 20μL of ProteinaseK solution, shake and mix, then add 200μL of buffer GB, fully invert and mix, place at 70°C for 10 minutes, and centrifuge briefly.

[0064] 3) Add 200 μL of absolute ethanol, shake and mix well for 15 sec. At this time, flocculent precipitation appears, and centrifuge briefly.

[0065] 4) Add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3 (the adsorption column is placed in the collection tube), centrifuge at 12000 rpm for 30 sec, discard the waste liquid, and put the adsorption column CB3 back into the collection tube.

[0066] 5) Add 500 μL of buffer GD (absolute ethanol has...

Embodiment 2

[0090] Example 2 Selection of Antigen Protector

[0091] Selection-Sucrose, trehalose, β-1,3 / 1,6 glucan, polyethylene glycol 6000, glycerol, gelatin were formulated as an antigen protective agent according to the formula in Table 1, and coated with Chlamydia MOMP under the best optimized conditions Protease target plate, after sealing and washing, add 200μL / well of antigen stabilizer (prescription 1, prescription 2, prescription 3, prescription 4, PBS control group), overnight at 4℃, remove the liquid in the well the next day, and add PBST Solution 300μL / well, wash 3 times, 3min each time, pat dry with absorbent paper, irradiate with UV for 2h, dry it, put it in a light-proof bag, store at 37℃ for 7 days, take out 4 holes every day and place at 4℃ surroundings. On the 12th day, take out all the ELISA plates, and take out the ELISA plates stored at -20°C (-20°C control group), test the positive control substance according to the determined ELISA procedure, repeat 4 wells, calcula...

Embodiment 3

[0097] Example 3 Preparation of an ELISA plate coated with recombinant Chlamydia psittaci protein MOMP

[0098] 1. Take the total DNA of Chlamydia psittaci 6BC strain as a template, and use specific primers MOMP-F and MOMP-R to amplify to obtain a 1143bp target fragment. The nucleotide sequence is shown in SEQ ID NO.2.

[0099] MOMP-F: AAAGAATTCTTGCCTGTAGGGAACCC;

[0100] MOMP-R: GGGGTCGACTTAGAATCTGAATTGAG;

[0101] 2. After the amplified fragments are recovered and purified, the target fragments are recovered and purified by double enzyme digestion with EcoRlI and SalI;

[0102] 3. Connect the digested target fragment with the PET28a(+) vector digested with the same enzyme to obtain a recombinant expression plasmid;

[0103] 4. Transform the recombinant plasmid into E. coli BL21 (DE3), culture at 37°C, and induce expression by IPTG;

[0104] 5. Centrifuge the bacterial solution to collect the precipitate, re-dissolve the precipitate in PBS, the pH 7.2 solution is subjected to ultrasonic ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a detection kit, and specifically discloses a kit for detecting avian chlamydia psittaci by enzyme linked immunosorbent assay. A genetic engineering expression recombinant protein MOMP is used as an antigen for wrapping a solid-phase carrier for enzyme linked immunosorbent assay adsorption detection. By the adoption of genetic engineering expression high-purity recombinant antigen as a wrapping antigen, the kit is high in specificity and high in sensitivity. After wrapping the solid-phase carrier, the antigen is protected with an antigen protector, so that the storage time of the antigen is prolonged. Furthermore, an enzyme linked antibody used in the kit is horse radish peroxidase-marked rabbit-anti bird IgG and can be widely used for detecting the universality of poultry such as chickens, ducks and gooses.

Description

Technical field [0001] The invention relates to a detection kit, in particular to a kit for the detection of Chlamydia psittaci by enzyme-linked immunosorbent. Background technique [0002] Avian Chlamydiosis (AvianChlamydiosis) is a kind of zoonotic diseases caused by Chlamydiapsittaci (Chlamydiapsittaci, Cp) in poultry, birds and mammals. It often manifests as symptoms of respiratory and digestive tract diseases in poultry. Infected poultry drowsiness, fever, weight loss, abnormal nasal and eye secretions, air sacculitis, peritonitis, pericarditis, perihepatitis, and decreased egg production in laying poultry, the fatality rate can be Up to 30%; after ornamental birds are infected, symptoms such as loss of appetite, weight loss, diarrhea, yellow stool, sinusitis, respiratory tract inflammation, hepatosplenomegaly, air sacculitis, pericarditis, and peritonitis are manifested. Occasionally, the disease can also infect cattle, sheep and other mammals, causing symptoms such as inf...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/68G01N33/569G01N33/543
CPCG01N33/543G01N33/56927G01N33/68G01N2333/95
Inventor 何诚吴宗学张强
Owner CHINA AGRI UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More