Kit for detecting avian chlamydia psittaci by enzyme linked immunosorbent assay
An ELISA detection technology for Chlamydia psittaci, which is applied in the field of ELISA detection kits for Chlamydia psittaci, can solve the problems that the result judgment is greatly affected by subjective factors, prone to false positives, and cumbersome test operations, etc. Achieve good market prospects, reduce the influence of subjective factors, and have good sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0060] Example 1 Preparation of recombinant protein MOMP
[0061] 1. Extract the total DNA of Chlamydia psittaci 6BC strain (DNA extraction kit purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.)
[0062] 1) Take 100 μL of the purified product of Chlamydia psittaci 6BC strain, add 200 μL of buffer GA, shake and mix.
[0063] 2) Add 20μL of ProteinaseK solution, shake and mix, then add 200μL of buffer GB, fully invert and mix, place at 70°C for 10 minutes, and centrifuge briefly.
[0064] 3) Add 200 μL of absolute ethanol, shake and mix well for 15 sec. At this time, flocculent precipitation appears, and centrifuge briefly.
[0065] 4) Add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3 (the adsorption column is placed in the collection tube), centrifuge at 12000 rpm for 30 sec, discard the waste liquid, and put the adsorption column CB3 back into the collection tube.
[0066] 5) Add 500 μL of buffer GD (absolute ethanol has...
Embodiment 2
[0090] Example 2 Selection of Antigen Protector
[0091] Selection-Sucrose, trehalose, β-1,3 / 1,6 glucan, polyethylene glycol 6000, glycerol, gelatin were formulated as an antigen protective agent according to the formula in Table 1, and coated with Chlamydia MOMP under the best optimized conditions Protease target plate, after sealing and washing, add 200μL / well of antigen stabilizer (prescription 1, prescription 2, prescription 3, prescription 4, PBS control group), overnight at 4℃, remove the liquid in the well the next day, and add PBST Solution 300μL / well, wash 3 times, 3min each time, pat dry with absorbent paper, irradiate with UV for 2h, dry it, put it in a light-proof bag, store at 37℃ for 7 days, take out 4 holes every day and place at 4℃ surroundings. On the 12th day, take out all the ELISA plates, and take out the ELISA plates stored at -20°C (-20°C control group), test the positive control substance according to the determined ELISA procedure, repeat 4 wells, calcula...
Embodiment 3
[0097] Example 3 Preparation of an ELISA plate coated with recombinant Chlamydia psittaci protein MOMP
[0098] 1. Take the total DNA of Chlamydia psittaci 6BC strain as a template, and use specific primers MOMP-F and MOMP-R to amplify to obtain a 1143bp target fragment. The nucleotide sequence is shown in SEQ ID NO.2.
[0099] MOMP-F: AAAGAATTCTTGCCTGTAGGGAACCC;
[0100] MOMP-R: GGGGTCGACTTAGAATCTGAATTGAG;
[0101] 2. After the amplified fragments are recovered and purified, the target fragments are recovered and purified by double enzyme digestion with EcoRlI and SalI;
[0102] 3. Connect the digested target fragment with the PET28a(+) vector digested with the same enzyme to obtain a recombinant expression plasmid;
[0103] 4. Transform the recombinant plasmid into E. coli BL21 (DE3), culture at 37°C, and induce expression by IPTG;
[0104] 5. Centrifuge the bacterial solution to collect the precipitate, re-dissolve the precipitate in PBS, the pH 7.2 solution is subjected to ultrasonic ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com