A biopesticide using siRNA to use plants as generators

A technology of biological pesticides and expression vectors, applied in the field of genetic engineering, can solve problems such as beneficial organisms, human health hazards, environmental pollution, and danger

Active Publication Date: 2018-08-31
JIANGSU MICROMEDMARK BIOTECH
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The loss of pesticides into the environment will cause serious environmental pollution, and sometimes even cause extremely dangerous consequences
[0005] Traditional pesticides have the following disadvantages: 1. Pollution of the air and water environment, causing soil compaction
2. Enhance the resistance of germs and pests to pesticides 3. Kill beneficial organisms 4. Wild life and livestock poisoning 5. Harm to human health
[0006] Although researchers have made preliminary studies on the use of RNA interference to control insect pests, there are still some difficult problems that limit its commercial development.
Among them, how to deliver siRNA and how to cull pests on a large scale are the main reasons hindering its application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A biopesticide using siRNA to use plants as generators
  • A biopesticide using siRNA to use plants as generators
  • A biopesticide using siRNA to use plants as generators

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Embodiment 1: construct the method for the plasmid vector of stably expressing exogenous siRNA in plant

[0034] This example provides specific methods for screening, obtaining and constructing a nucleic acid construct vector containing the target gene. Through screening, multiple siRNA sequences that can target and kill pests are obtained.

[0035] The following are the target genes and corresponding siRNA sequences:

[0036] Plutella xylostella target gene: CATGCCTGGTGATGTAATA (SEQ ID NO.1)

[0037] Sense strand: CAUGCCUGGUGAUGUAAUA (SEQ ID NO.2)

[0038] Antisense strand: UAUUACAUCACCAGGCAUG (SEQ ID NO.3)

[0039] Aphid target gene: TGGTTGGTATTAGAAACAATGTT (SEQ ID NO.4)

[0040] Sense strand: UGGUUGGUAUUAGAAACAAUGUU (SEQ ID NO.5)

[0041] Antisense strand: AACAUUGUUUCUAAUACCAACCA (SEQ ID NO.6)

[0042] Drosophila melanogaster target gene: AACTATAAAGTTGATGATATTAT (SEQ ID NO.7)

[0043] Sense strand: AACUAUAAAGUUGAUGAUAUUAU (SEQ ID NO.8)

[0044] Antisense stra...

Embodiment 2

[0138] Embodiment 2: exogenous siRNA expression vector transforms cruciferous lettuce

[0139] Target siRNA sense strand nucleotide sequence (sequence is as follows):

[0140] 5'-CAUGCCUGGUGAUGUAAUA-3' (SEQ ID NO.2)

[0141] 5'-UGGUUGGUAUUAGAAACAAUGUU-3' (SEQ ID NO.5)

[0142] 5'-AACUAUAAAGUUGAUGAUAUUAU-3' (SEQ ID NO.8)

[0143] 5'-UAUACGCUAUCUGAUACCAUGUA-3' (SEQ ID NO.11)

[0144] 5'-UCGUACCAUCGAGUACCUACG-3' (SEQ ID NO.14)

[0145] 5'-GUAUCGGUAUAGCCGAUCGUA-3' (SEQ ID NO.17)

[0146] 5'-CUAACGAACUAUGCCGCGUAUA-3' (SEQ ID NO.18)

[0147] The experiments of transforming plants all included culture of sterile seedlings, infection of Agrobacterium EHA105 with the recombinant expression vector constructed in Example 1, culture of plant callus bud induction, and seedling root induction culture. Specifically include the following steps:

[0148] The transformed plants were respectively adopted the leaf disc method mediated by Agrobacterium.

[0149] The surface of the lettuce ...

Embodiment 3

[0163] Example 3 Transformation of Poaceae Lolium with Exogenous siRNA Expression Vector

[0164] The transformed plants were induced by Agrobacterium.

[0165] According to the routinely used Agrobacterium dipping method, the aseptically cultured young ryegrass embryos were co-cultured with the recombinant Agrobacterium described in Example 2, so as to transfer the T-DNA in the recombinant expression vector constructed in Example 1 into Into the ryegrass chromosome, a ryegrass plant (positive control) transformed with exogenous siRNA was obtained; at the same time, wild-type ryegrass was used as a negative control.

[0166] For Agrobacterium-mediated transformation of ryegrass, briefly, immature embryos are isolated from ryegrass, and the embryos are contacted with a suspension of Agrobacterium capable of delivering a nucleotide sequence to at least one of the embryos. A cell with the nucleic acid construct operably linked to the ryegrass genome. In this step, the immature ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of genetic engineering, and relates to a biological pesticide using siRNA and taking a plant as a generator. The biological pesticide takes a plant, which expresses siRNA for a key gene of the metabolism of life of a pest, as a raw material. The siRNA is expressed by a transgenic plant, and can silence the targeted key gene of the metabolism of life of a pest through an RNAi mechanism after being touched or eaten by the pest. The invention aims to design the siRNA specifically targeting the key gene of the metabolism of life of the pest, and creatively takes the plant as a siRNA carrier to produce the biological pesticide. By transferring a siRNA template sequence of a highly-targeted pest into the plant and enabling the plant to express a corresponding target siRNA, this type of transgenic plant is planted in a large area, and an extract of the plant is used for manufacturing the biological pesticide which is harmless to the environment, can kill pests from the gene level, can hinder the development of the pests, is high in killing efficiency, and cannot cause pest resistance easily.

Description

technical field [0001] The invention belongs to the field of genetic engineering and relates to a biopesticide using siRNA with plants as generators. Background technique [0002] Small interfering ribonucleic acid (siRNA) is a type of double-stranded RNA molecule composed of more than 20 nucleotides, which can silence gene expression by specifically degrading the messenger RNA (mRNA) of the target gene. One process is called RNA interference (RNA interference, RNAi), which plays an important role in gene regulation and growth and development. [0003] RNA interference (RNAi) is an antiviral mechanism. It is the post-transcriptional gene silencing of sequence-specific homologous genes mediated by dsRNA, and the effective mode of action in cells is siRNA. RNA interference can use siRNA or siRNA expression vector to specifically silence the target gene. This method is fast, economical, simple, and has a high degree of sequence specificity. It can obtain the loss of function ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): A01N57/16A01P7/04C12N15/84C12N5/10
Inventor张辰宇洪治曾科
OwnerJIANGSU MICROMEDMARK BIOTECH