Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Rice cadmium-tolerant gene OsGSTU37 and application thereof

A cadmium-resistant gene technology, applied in the fields of biotechnology and crop genetic engineering, can solve the problems of rice cadmium-tolerant ability and cadmium accumulation ability difference

Inactive Publication Date: 2016-07-13
RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI
View PDF2 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Studies have shown that under the same cadmium pollution, there are great differences in the cadmium tolerance and cadmium accumulation ability of different rice varieties

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice cadmium-tolerant gene OsGSTU37 and application thereof
  • Rice cadmium-tolerant gene OsGSTU37 and application thereof
  • Rice cadmium-tolerant gene OsGSTU37 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 Yeast ectopic expression of rice cadmium-tolerant gene OsGSTU37

[0033] Step 1. Design of primers

[0034]According to the whole genome sequence of rice variety Nipponbare (Oryzasativa Lcv. Nipponbare) provided by NCBI, the amplification primers were designed according to the coding region (CDS) sequence (SEQ ID NO: 3) of the rice cadmium-tolerant gene OsGSTU37, and restriction sites were added to the primers .

[0035] Specifically designed primers are: forward primer (SEQIDNO: 4) with NcoI at the 5' end, restriction site (CCATGG), reverse primer (SEQ ID NO: 5) with BamHI at the 5' end, restriction site (GGATCC), The primer sequences are as follows:

[0036] Forward primer: CCATGGATGGCCGATCCGGTTAAGCTCANcoI

[0037] Reverse primer: GGATCCCTGATGCACCATCGCCCTGAACBamHI

[0038] Step 2 Acquisition of gene OsGSTU37

[0039] Using rice cDNA as a template, the gene OsGSTU37 was amplified using the above-mentioned forward primer and reverse primer. The enzyme use...

Embodiment 2

[0060] Example 2 Obtaining of Overexpression Line of Rice Cadmium-tolerant Gene OsGSTU37

[0061] 1.1, the construction of the overexpression vector of gene OsGSTU37

[0062] Step 1. Design of primers

[0063] According to the whole genome sequence of rice variety Nipponbare (Oryzasativa Lcv. Nipponbare) provided by NCBI, the amplification primers were designed according to the CDS (SEQ ID NO: 3) sequence of the rice cadmium-tolerant gene OsGSTU37, and the enzyme cutting sites of the primers were designed according to the selected vector.

[0064] The overexpression vector was constructed using pCAMBIA1300, the entire coding frame of the vector was driven by the maize Ubiquitin gene promoter and fused with FLAG tag. Specifically designed primers are: forward primer (SEQ ID NO: 6) with HindIII at the 5' end, restriction site (AAGCTT), reverse primer (SEQ ID NO: 7) with KpnI at the 5' end, restriction site (GGTACC), The primer sequences are as follows:

[0065] Forward primer...

Embodiment 3

[0089] Example 3 Obtaining of rice cadmium-tolerant gene OsGSTU37 knockout line

[0090] 1.1 Construction of rice cadmium tolerance gene OsGSTU37 knockout vector

[0091] According to the whole genome sequence of rice variety Nipponbare (Oryzasativa Lcv. Nipponbare) provided by NCBI, and according to the sequence of rice cadmium-tolerant gene OsGSTU37, a target site KO (SEQ ID NO: 12) primer was designed on the exon of the gene, and the target site When designing the point, pay attention to the requirement that the PAM sequence of the last site is NGG, and the primer sequence is as follows (SEQ ID NO:13-14):

[0092] KOFP:TGTGTACTGGAGGCACAGCTCGAG

[0093] KORP:AAACCTCGAGCTGTGCCTCCAGTA

[0094] After the primers are fully dissolved, anneal the primers according to the system in Table 1.

[0095] Table 1 Primer annealing system

[0096]

[0097] Reaction conditions: 37°C, 1h.

[0098] Add 2.5ul 1M NaCl, 95°C, 5s. Turn off the incubator and let it anneal naturally for 2-...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rice cadmium-tolerant gene OsGSTU37 and application thereof.Sequences of the rice cadmium-tolerant gene OsGSTU37 are shown as SEQ ID NO:1 in sequence tables, and amino acid sequences of glutathione S-transferase (GSTs) of an encoding protein of the rice cadmium-tolerant gene OsGSTU37 are shown as SEQ ID NO:2 in the sequence tables.As proved by ectopic expression of yeast, the rice cadmium-tolerant gene OsGSTU37 has cadmium toxicity tolerant characteristics.The rice cadmium-tolerant gene OsGSTU37 and the application have the advantages that knockout lines and over-expression lines of the rice cadmium-tolerant gene OsGSTU37 are constructed, as discovered in seed germination comparative experiments on the knockout lines, the over-expression lines and wild type rice, the knockout lines of the rice cadmium-tolerant gene OsGSTU37 are poor under cadmium stress, but the over-expression lines of the rice cadmium-tolerant gene OsGSTU37 and the wild type rice can germinate, and germination and growth of the over-expression lines of the rice cadmium-tolerant gene OsGSTU37are superior to germination and growth of the wild type rice; important effects of the rice cadmium-tolerant gene OsGSTU37 in cadmium-tolerant mechanisms can be equivalently described; over-expression vectors of the rice cadmium-tolerant gene OsGSTU37 are constructed, and plants are transformed by the aid of the over-expression vectors, so that cadmium-tolerant plant varieties can be obtained, the cadmium stress resistance of the plants can be improved, and theoretical bases can be provided for breeding novel cadmium-tolerant crop varieties.

Description

technical field [0001] The invention relates to the technical fields of biotechnology and crop genetic engineering. Specifically, the present invention relates to a rice cadmium-tolerant gene OsGSTU37 and its encoded protein and application. Background technique [0002] According to the "National Soil Pollution Survey Bulletin" released for the first time on April 17, 2014, the quality of my country's cultivated land soil environment is worrying, and the rate of soil pollution points exceeding the standard is 19.4%. Lead, antimony and polycyclic aromatic hydrocarbons, among which cadmium points exceed the standard rate of 7.0%, ranking first in pollution. As a non-essential element for plant growth, cadmium seriously affects the normal growth of plants. Plants are poisoned by cadmium, resulting in reduced root activity, reduced photosynthesis, growth inhibition until death. Cd 2+ When it is harmed, it will also activate the adversity stress pathway to generate reactive ox...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/54C12N9/10C12N15/84A01H5/00
CPCC12N9/1088C12N15/8205C12N15/8271C12Y205/01018
Inventor 秦瑞英杨剑波李莉杨亚春魏鹏程李浩李娟许蓉芳
Owner RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com