Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of human bocavirus type 1 antibody indirect ELISA diagnostic kit

A technology for human Boca virus and diagnostic kit, which is applied to measurement devices, instruments, scientific instruments, etc., can solve problems such as difficult preparation, and achieve the effects of easy purification, short time consumption and low cost

Active Publication Date: 2018-04-24
WUHAN INST OF BIOENG
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the preparation of VP2 protein is very difficult, and the screening of highly immunogenic antigen genes that can be expressed stably and in large quantities is the key to establishing a reliable ELISA diagnostic method for human bocavirus infection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of human bocavirus type 1 antibody indirect ELISA diagnostic kit
  • A kind of human bocavirus type 1 antibody indirect ELISA diagnostic kit
  • A kind of human bocavirus type 1 antibody indirect ELISA diagnostic kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] 1. Cloning of human bocavirus type 1 VP2N gene and construction of prokaryotic expression vector

[0025] Refer to the genome sequence of human Bocavirus type 1 (GU139423.1) in GenBank to design specific primers for the VP2N gene fragment (the gene fragment encoding the N-terminal 210 amino acid truncated protein of human Bocavirus type 1 structural protein VP2). The primer sequences are:

[0026] Upstream primer: C GAGCTC TCTGACACTGACATTCAAGA, the underlined part is the Sac I restriction site,

[0027] Downstream primer: CCC AAGCTT ATTGCCTCCAGCTGCA, the underlined part is the Hind III restriction site.

[0028] The VP2N-specific target gene with a size of 630bp was amplified by PCR, and then ligated with the pET28a(+) expression vector to construct the prokaryotic expression vector pET28a-VP2N. PCR, double enzyme digestion and sequencing identification showed that the VP2N gene prokaryotic was successfully constructed Expression vector, its electrophoresis diagra...

Embodiment 2

[0032] 1. Preparation of ELISA antibody detection plate

[0033] The purified VP2N recombinant protein was diluted to a certain concentration with carbonate buffer solution of pH 9.6 as the coating solution, added to the microtiter plate at 100 μL / well, and coated overnight at 4°C. Wash the plate four times with PBST, add 200 μL of 1×blockingbuffer to each well to block at 37°C for 1 hour, wash the plate four times with PBS, dry at room temperature, put in a desiccant and vacuum pack to obtain an ELISA antibody detection plate, and store at 4°C.

[0034] 2. ELISA method operating procedure

[0035] (1) Dilute the 10× concentrated washing solution 10 times to obtain the washing solution.

[0036] (2) Serum to be tested, VP2N antibody positive control serum and negative control serum were diluted 1:100 times with antibody diluent (1×blocking buffer), added to ELISA antibody detection plate at 100 μL per well, and incubated at 37°C for 40 minutes. Shake dry.

[0037] (3) Add 2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a human bocavirus type 1 antibody indirect ELISA diagnosis kit. The kit comprises an antigen coated ELISA antibody detection plate and an enzyme-labeled secondary antibody, the antigen coated on the antibody detection plate is the truncated protein (VP2N) of 210 amino acids at the N terminal of a human bocavirus type 1 structure protein VP2, and the enzyme-labeled secondary antibody is a sheep anti-human enzyme-labeled secondary antibody. The amino acid sequence of the truncated protein VP2N is represented by SEQ ID NO.1, and the coding sequence of the truncated protein VP2N is represented by SEQ ID NO.2. The VP2N recombinant protein adopted in the invention is convenient for massive preparation and purification. The kit can be used for detecting a human bocavirus type infected antibody or diagnosing human bocavirus type infection, and has the advantages of simplicity and fastness in operation, short time, low cost, extreme suitableness for detecting a large amount of individual serum samples, and very high practicality.

Description

technical field [0001] The invention relates to a diagnostic kit, in particular to a human bocavirus type 1 antibody indirect ELISA diagnostic kit. Background technique [0002] Human bocavirus 1 (HBoV1) is a novel parvovirus discovered in large-scale screening of acute respiratory infection samples in children. Since the discovery of human bocavirus type 1, some countries and regions have successively reported that the virus was detected in respiratory specimens of patients with upper and lower respiratory tract infections, proving that human bocavirus exists worldwide. The epidemic has become a global problem. In my country, samples of human bocavirus infection have been detected in Zhejiang Province, Hunan Province, Beijing, Hong Kong, and Taiwan. Most of the people who are susceptible to human bocavirus infection are infants and young children under 2 years old. The related respiratory diseases mainly include pneumonia, bronchitis, rhinitis, and pharyngitis. Wait. It...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): G01N33/569G01N33/531
CPCG01N33/531G01N33/56983
Inventor 李毅朱记平冯小婷王小梅
Owner WUHAN INST OF BIOENG