Recombinant vector for luciferase based on pCDH and application thereof

A technology of recombinant vector and luciferase, which is applied in the field of genetic engineering to achieve the effects of high infectivity, high sensitivity and low background noise

Inactive Publication Date: 2017-03-15
HENAN HUALONG BIOLOGICAL TECH
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But the current luciferase gene is not reported to be connected to the pCDH vector, nor is the luciferase gene used for CD19 tracking

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant vector for luciferase based on pCDH and application thereof
  • Recombinant vector for luciferase based on pCDH and application thereof
  • Recombinant vector for luciferase based on pCDH and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1: Construction of pCDH-CAR19 lentiviral vector

[0038] pCDH-Luc lentiviral vector, such as figure 1 Shown:

[0039] (1) According to the known pET28-Luc as the template to replace the primers at the restriction sites, the designed primers are as follows:

[0040] Upstream primer: CGCGGATCCATGGCCTTACCAGTGACCGCTCCGGT (BamHI-Luc-A);

[0041] Downstream primer: CCAGCGGCCGCAATCGCTCCCCCGTCCCGGA(Luc-NotI-S);

[0042] In order to facilitate the construction of the recombinant vector pCDH-Luc, we artificially added the enzyme cutting sites BamHI and NotI required for vector construction when synthesizing Luc.

[0043] The PCR amplification reaction system is as follows:

[0044]

[0045] Among them, a group of negative controls with water as the sample.

[0046] The reaction conditions are as follows:

[0047]

[0048]

[0049] The obtained PCR product was identified by 1% agarose gel electrophoresis, recovered and purified with a gel recovery kit, NotI ...

Embodiment 2

[0056] Example 2: Mass extraction of pCDH-Luc plasmid

[0057] Take out the corresponding strains from -80°C, streak on the plate, and culture overnight (12-24h); pick a single clone (2-4) the next day, and shake the bacteria (6-8h) in a small volume (5ml); Take the bacterial liquid from the shaking system, and turn it to a large shake according to the volume ratio of 1:100; then carry out the plasmid extraction:

[0058] First confirm whether RNaseA has been added to Solution1 (save at 4°C after adding RNaseA); whether absolute ethanol has been added to DNAWashBuffer.

[0059] BufferN3 can be pre-cooled in ice before use; if Solution1 is not used for the first time, it needs to be taken out from 4°C and equilibrated at room temperature.

[0060] (1) Take an appropriate amount of bacterial solution and place it in a new 50mL centrifuge tube, centrifuge at 4900g for 10min at room temperature, discard the supernatant and continue to add an appropriate amount of bacterial soluti...

Embodiment 4

[0074] Example 4: Packaging of lentivirus and cell transfection

[0075] Lentivirus packaging: co-transfect 293T cells with the constructed lentivirus expression vector and packaging plasmid, package the virus, collect and concentrate the virus liquid, store and dilute, and perform titer detection and MOI value determination, titer > 1.00E+ 08TU / mL, MOI value between 5-10.

[0076] Cell transfection: (1) 24 hours before transfection, digest 293T cells in the logarithmic growth phase (cell confluency is 85%-95%) with trypsin (0.125%), and use complete medium (DMEM: 4.5g / Lglucose with NaHCO 3 or sodium pyruvate + 5% or 10% serum + 1mg / ml double antibody) to adjust the cell density (1:4-5) for passage, and re-seeded in culture vessels (T75 bottles or d15 culture dishes) for culture (37 ° C, 5% CO2, saturated humidity);

[0077] (2) After 24 hours of transfection, the cell confluence density reaches 45-65%;

[0078] (3) Replace the cell culture medium with fresh pure culture ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention specifically relates to a recombinant vector for luciferase based on pCDH and application thereof, belonging to the field of genetic engineering. The recombinant vector is formed by tandem connection of a lentiviral vector pCDH and a luciferase gene and has a nucleotide sequence as shown in SEQ ID No. 1. A luciferase gene mediated by the recombinant vector expresses luciferase in raji cells; and in virtue of the principles of a reaction of a substrate under enzymatic catalysis, the recombinant vector is applied to tracking of CD19 in living imaging research on a model animal so as to evaluate the target killing effect of CAR-T cells.

Description

technical field [0001] The invention belongs to the field of genetic engineering and relates to a recombinant vector and its application, in particular to a pCDH-based luciferase recombinant vector and its application. Background technique [0002] Luciferase is a general term for a class of enzymes that catalyze the oxidation and luminescence of luciferin or aliphatic aldehydes in organisms. Because luciferase detection is simple, sensitive and rapid, luciferase gene has become a widely used reporter gene in genetic engineering. In recent years, optical reporter gene imaging has become a hotspot in molecular imaging research due to its advantages of high sensitivity, no radioactivity, rapid imaging, and real-time monitoring, and has therefore become an ideal imaging method for tracking cells in vivo. Optical reporter gene imaging techniques mainly include bioluminescence imaging and fluorescence imaging. [0003] Raji cells are human B lymphoma leukemia cells, the cell li...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/867C12N15/66C12N15/65C12N7/01C12N5/10
CPCC12N7/00C12N15/65C12N15/66C12N15/86C12N2740/15021C12N2740/15043
Inventor韦丹赵礼军连杰李德志付苏雷吴雷振
OwnerHENAN HUALONG BIOLOGICAL TECH