A kind of method that recombinant bacterium catalyzes rebaudioside a to prepare rebaudioside m2

A recombinant bacteria and source technology, applied in the field of genetic engineering, can solve the problems of low content of rebaudioside M2, high cost of enzyme production and high cost, and achieve the effects of better environmental friendliness, simplified process and reduced cost

Active Publication Date: 2020-03-17
NANJING TECH UNIV
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, the content of rebaudioside M2 ​​is low, so it is difficult to realize large-scale preparation and industrialization
[0007] In addition, the reported biological preparation methods of rebaudioside M (patents CN201310353500.9 and CN201410019981.4) use recombinant cells as catalysts and need to add toluene or other cell permeabilizing agents; or use recombinant cell lyophilized powder as catalysts , but the preparation of freeze-dried powder consumes energy and costs high; and additional UDP needs to be added as a co-substrate of the UDP-glucose regeneration system; or the addition ratio of UDP-glycosyltransferase and sucrose synthase needs to be adjusted, and the amount of recombinant bacteria is large , high cost of enzyme production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of method that recombinant bacterium catalyzes rebaudioside a to prepare rebaudioside m2
  • A kind of method that recombinant bacterium catalyzes rebaudioside a to prepare rebaudioside m2
  • A kind of method that recombinant bacterium catalyzes rebaudioside a to prepare rebaudioside m2

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1 Construction of recombinant strains

[0028] The gene sequence of tomato-derived glycosyltransferase UGTSL2 is shown in SEQ.NO.1, and the gene sequence of potato-derived sucrose synthase StSUS1 is shown in SEQ.NO.2 and synthesized by Nanjing GenScript after codon optimization. Primers GGGAATTCCATATGGCGACCAACCTGCG and CCGCTCGAGTTAGTGGTGATGATGGTGATGTTTG were designed to amplify the UGTSL2 gene, and the gene was subcloned into pRSFDuet-1 (Novagen) between the NdeI and XhoI sites to construct the recombinant plasmid pRSFDuet-SL2; primers were designed for TAATAAGGAGATATACCATGGCCGAACGTGTCCTGACCC and AGGCGCGTCGAGCTCGA The one-step cloning kit (OneStep Cloning Kit, Vazyme) of Science and Technology Co., Ltd. subcloned the StSUS1 gene into the NcoI and EcoRI sites of pRSFDuet-SL2 to construct the recombinant plasmid pRSFDuet-SL2-SUS1. In the molecular cloning operation, TransFastTaq DNA polymerase was purchased from Beijing Quanshijin Biotechnology Co., Ltd., and T4 D...

Embodiment 2

[0029] Example 2 Induced expression of recombinant enzyme and preparation of crude enzyme solution

[0030] The pRSFDuet-SL2-SUS1 constructed in Example 1 was transformed into Escherichia coli BL21 (DE3) to obtain recombinant BL21 (pRSFDuet-SL2-SUS1). Inoculate the recombinant bacterial strain into 5mL LB medium (0.5g / L yeast powder, 0.5g / L sodium chloride, 1g / L tryptone) containing 0.05g / L kanamycin, shake at 37°C and 250rpm Cultivate for 8 hours, then insert the culture solution into 100mL induction medium (25g / L yeast powder, 15g / L tryptone, 10g / L sodium chloride, 2g / L glucose, 0.05g / L lactose ) in a 500mL shake flask, cultured at 200rpm, 30℃ for 2h, until OD 600 When it reaches about 0.2, turn to 25°C to induce 22h and centrifuge to collect the bacteria. Sonicate the bacteria, centrifuge and take the supernatant as a crude enzyme solution, and store it in a 4°C refrigerator for later use.

Embodiment 3

[0031] Example 3 Effects of Temperature on Induced Expression of Recombinant Strains

[0032] Inoculate the recombinant bacteria into 5mL LB medium (0.5g / L yeast powder, 0.5g / L sodium chloride, 1g / L tryptone) containing 0.05g / L kanamycin, and culture with shaking at 250rpm at 37°C 8h, then add the culture solution into 100mL induction medium (25g / L yeast powder, 15g / L tryptone, 10g / L sodium chloride, 2g / L glucose, 0.05g / L lactose) according to the inoculum amount of 2% In a 500mL shake flask, cultured at 200rpm at 30°C for 2h, until the OD 600 When it reaches about 0.2, induce 22 hours of centrifugation at 20°C, 25°C, 30°C, and 37°C to collect the bacteria, ultrasonically destroy the bacteria, and centrifuge to get the supernatant as a crude enzyme solution, and put it in a 4°C refrigerator for use.

[0033] Take the crude enzyme solution obtained at different induction temperatures, react for 25 hours under the conditions of temperature 30°C, pH 7.2, rebaudioside A 10g / L, su...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant bacterium and application of the recombinant bacterium to preparation of rebaudioside M2 by catalyzing rebaudioside A. The recombinant bacterium contains a tomato-based glycosyltransferase UGTSL2 gene and a potato-based sucrose synthase StSUS1 gene at the same time; the tomato-based glycosyltransferase UGTSL2 gene is cloned between NdeI and XhoI sites of pRSFDuet-1 and is constructed to obtain a recombinant plasmid pRSFDuet-SL2; then the potato-based sucrose synthase StSUS1 gene is cloned between NcoI and EcoRI sites of the pRSFDuet-SL2 and is constructed to obtain a recombinant plasmid pRSFDuet-SL2-SUS1; the recombinant plasmid pRSFDuet-SL2-SUS1 is transferred into a host cell to obtain the recombinant bacterium. After the recombinant bacterium is subjected to induced expression, crude enzyme liquid is taken and is added into a reaction mixture to catalyze the rebaudioside A to generate the rebaudioside M2; in a reaction process, the crude enzyme liquid obtained by crushing the recombinant bacterium is utilized and separation and purification of an enzyme are avoided; lyophilized powder is also not needed and substrates including rebaudioside D and UDP or UDP-glucose and any cell penetration agent or other chemical reagents do not need to be added, so that the environmental friendliness is better. The yield of the rebaudioside M2 reaches 11.09g / L.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a method for preparing rebaudioside M2 ​​by catalyzing rebaudioside A with recombinant bacteria. Background technique [0002] Stevioside is extracted from the perennial Compositae herb Stevia rebaudiana native to Paraguay and Brazil in South America. It has high sweetness (250-300 times that of sucrose), low calorie (only 1 / 300 of sucrose), and is safe to eat , has a certain pharmacological effect and auxiliary curative effect. It is the third natural sucrose substitute with development value and health admiration after cane sugar and beet sugar, and is known internationally as "the third sugar source in the world". In 1998, the U.S. Food and Drug Administration (FDA) agreed to add stevia to food and beverages. Switzerland listed stevioside in its national pharmacopoeia as the main sweetener raw material for syrups, oral liquids or lozenges, replacing t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12P19/56C12N1/21C12R1/19
CPCC12N9/1048C12N9/1062C12P19/56C12Y204/01013
Inventor李艳陈可泉周芳芳郝宁欧阳平凯
OwnerNANJING TECH UNIV