A fowl adenovirus group I serum type 4 genetic engineering subunit vaccine, and a preparing method and applications thereof

A vaccine and gene technology, applied in the directions of genetic engineering, botanical equipment and methods, biochemical equipment and methods, etc., can solve problems such as difficulty in culturing chicken embryo liver cells, loopholes in prevention and control of group I avian adenovirus, and difficulty in popularization and application. , to achieve the effect of low cost, easy amplification and strong immunogenicity

Active Publication Date: 2017-07-14
苏州沃美生物有限公司
View PDF5 Cites 26 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Regarding the prevention and treatment of the disease, there is currently no commercial vaccine that can prevent group I adenovirus in China, which leads to loopholes in the prevention and control of group I adenovirus
[0004] CN106075427A discloses a preparation method of type I poultry adenovirus vaccine and egg yolk antibody, which is mainly by inoculating isolated FAV virus into hepatocytes of chicken embryos for propagation, then harvesting the virus and inactivating the vaccine to prepare the vaccine. The FAV vaccine is inactivated live virus vaccines, and the cultivation of chicken embryo liver cells is very difficult, so it is difficult to popularize and apply

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A fowl adenovirus group I serum type 4 genetic engineering subunit vaccine, and a preparing method and applications thereof
  • A fowl adenovirus group I serum type 4 genetic engineering subunit vaccine, and a preparing method and applications thereof
  • A fowl adenovirus group I serum type 4 genetic engineering subunit vaccine, and a preparing method and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] The construction of embodiment 1 recombinant baculovirus:

[0065] Using the Bacto Bac system to construct recombinant baculovirus,

[0066] According to the hexon gene sequence published by GeneBank, the following primers were designed to amplify the gene of the hexon antigen region

[0067] HX-P1: GGATCCATGGGAAGCTACTTTGACTTGAAAAAC

[0068] HX-P2: GAATTCGTATTCGGTGCCCGCGTTATTC

[0069] The genome of the isolated group I serotype 4 avian adenovirus MD-4 strain was extracted, and its genome was used as a template, and HX-P1 and HX-P2 were used as primers to amplify the gene fragment Hx of the main antigen region of the hexon, and the The gene was cloned into the pMD-19T vector to obtain the recombinant vector pMD-Hx. Then pMD-Hx was digested by BamHI and EcoRI, and the Hx gene fragment was cloned into the transfer vector pFastBac 1 to construct the recombinant vector pF-Hx.

[0070] According to the E. coli heat-sensitive toxin B subunit gene sequence and the E. coli ...

Embodiment 2

[0082] Transform the recombinant transfer vector pMD-Hx-STLT-Pt into Escherichia coli DH10Bac to obtain the recombinant plasmid Bacmid-Hx-STLT-Pt inserted into the fusion antigen protein gene of group I serotype 4 avian adenovirus, and transfect the recombinant plasmid into insects In Sf9 cells, the recombinant baculovirus rBac-Hx-STLT-Pt was obtained, and the recombinant baculovirus rBac-Hx-STLT-Pt was amplified as a seed virus for future use.

[0083] SDS-PAGE detection: The harvested cell cultures were subjected to SDS-PAGE detection, and Sf9 cells infected with empty baculovirus were used as a negative control. The specific operation is as follows: take 40 μl of harvested cell culture, add 10 μl of 5×loadingbuffer, bathe in boiling water for 5 minutes, centrifuge at 12000 r / min for 1 minute, take the supernatant and carry out SDS-PAGE gel (12% concentration gel) electrophoresis, electrophoresis Afterwards, the gel was stained and decolorized to observe the target band. Su...

Embodiment 3

[0088] Example 3 Bioreactor Serum-Free Suspension Culture of Insect Cells and Quantitative Expression of Hx-STLT-Pt Protein and Determination of Agar Expansion Titer

[0089] Aseptically culture sf9 insect cells in a 1000ml shake flask for 3-4 days until the concentration reaches 3-5×10 6 cell / mL, when the viability is greater than 95%, inoculate the cells into a 5L bioreactor with an inoculation concentration of 3-8×10 5 cell / mL. When the cell concentration reaches 3-55 × 10 6 When cell / mL, inoculate the cells into a 50L bioreactor, and wait for the cells to grow to a concentration of 3-55×10 6 cell / mL, inoculate into a 500L bioreactor until the cell concentration reaches 2-85×10 6 When cell / mL, the recombinant baculovirus rBac-Hx-STLT-PT was inoculated, and the reactor culture conditions were pH 6.0-6.5, temperature 25-27°C, dissolved oxygen 30-80%, and stirring speed 100-180rpm. Considering the optimal conditions for cell culture, the preferred pH is 6.2, the temperatur...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

A fowl adenovirus group I serum type 4 genetic engineering subunit vaccine, and a preparing method and applications thereof are disclosed. The sequence of an antigen protein in the vaccine is shown as SEQ ID NO:1. The antigen protein has advantages of high safety, high immunity, no pathogenicity for chickens or other animals, and the like. The subunit vaccine can prevent chicken hydropericardium syndrome, inclusion body hepatitis and other diseases which are caused by infection of fowl adenovirus group I serum type 4.

Description

technical field [0001] The invention specifically relates to a genetically engineered subunit vaccine of group I serotype 4 avian adenovirus, its preparation method and application. Background technique [0002] Fowl adenovirus group I serum type 4 (FAV-4) belongs to adenovirus group A. Group I poultry adenovirus particles are spherical, with a diameter of 70-90nm, no envelope, icosahedral symmetry, 12 vertices, and a regular icosahedron composed of 20 regular triangles. The surface is composed of 252 hollow particles with a length of 10-11nm and a width of 5-6nm, and a pith core with a diameter of 60-65nm in the middle. Its nucleic acid is double-strand linear DNA, replicated in the nucleus, with a molecular weight of 3×10 7 Da, which accounts for 11.2% to 13.5% of the whole virion, the rest is protein, penton, and hexon are the main structural proteins of FAD, which together constitute the viral nucleocapsid. [0003] In 1987, Angola, near Karachi, Pakistan, first repor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/866C12N15/66C12N5/10A61K39/235A61P31/20
CPCA61K39/12C07K14/005C07K2319/55C12N15/66C12N15/86C12N2710/10222C12N2710/10234C12N2710/14043C12N2760/18522
Inventor曹文龙滕小锘张大鹤易小萍
Owner苏州沃美生物有限公司