A fowl adenovirus group I serum type 4 genetic engineering subunit vaccine, and a preparing method and applications thereof
A vaccine and gene technology, applied in the directions of genetic engineering, botanical equipment and methods, biochemical equipment and methods, etc., can solve problems such as difficulty in culturing chicken embryo liver cells, loopholes in prevention and control of group I avian adenovirus, and difficulty in popularization and application. , to achieve the effect of low cost, easy amplification and strong immunogenicity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0064] The construction of embodiment 1 recombinant baculovirus:
[0065] Using the Bacto Bac system to construct recombinant baculovirus,
[0066] According to the hexon gene sequence published by GeneBank, the following primers were designed to amplify the gene of the hexon antigen region
[0067] HX-P1: GGATCCATGGGAAGCTACTTTGACTTGAAAAAC
[0068] HX-P2: GAATTCGTATTCGGTGCCCGCGTTATTC
[0069] The genome of the isolated group I serotype 4 avian adenovirus MD-4 strain was extracted, and its genome was used as a template, and HX-P1 and HX-P2 were used as primers to amplify the gene fragment Hx of the main antigen region of the hexon, and the The gene was cloned into the pMD-19T vector to obtain the recombinant vector pMD-Hx. Then pMD-Hx was digested by BamHI and EcoRI, and the Hx gene fragment was cloned into the transfer vector pFastBac 1 to construct the recombinant vector pF-Hx.
[0070] According to the E. coli heat-sensitive toxin B subunit gene sequence and the E. coli ...
Embodiment 2
[0082] Transform the recombinant transfer vector pMD-Hx-STLT-Pt into Escherichia coli DH10Bac to obtain the recombinant plasmid Bacmid-Hx-STLT-Pt inserted into the fusion antigen protein gene of group I serotype 4 avian adenovirus, and transfect the recombinant plasmid into insects In Sf9 cells, the recombinant baculovirus rBac-Hx-STLT-Pt was obtained, and the recombinant baculovirus rBac-Hx-STLT-Pt was amplified as a seed virus for future use.
[0083] SDS-PAGE detection: The harvested cell cultures were subjected to SDS-PAGE detection, and Sf9 cells infected with empty baculovirus were used as a negative control. The specific operation is as follows: take 40 μl of harvested cell culture, add 10 μl of 5×loadingbuffer, bathe in boiling water for 5 minutes, centrifuge at 12000 r / min for 1 minute, take the supernatant and carry out SDS-PAGE gel (12% concentration gel) electrophoresis, electrophoresis Afterwards, the gel was stained and decolorized to observe the target band. Su...
Embodiment 3
[0088] Example 3 Bioreactor Serum-Free Suspension Culture of Insect Cells and Quantitative Expression of Hx-STLT-Pt Protein and Determination of Agar Expansion Titer
[0089] Aseptically culture sf9 insect cells in a 1000ml shake flask for 3-4 days until the concentration reaches 3-5×10 6 cell / mL, when the viability is greater than 95%, inoculate the cells into a 5L bioreactor with an inoculation concentration of 3-8×10 5 cell / mL. When the cell concentration reaches 3-55 × 10 6 When cell / mL, inoculate the cells into a 50L bioreactor, and wait for the cells to grow to a concentration of 3-55×10 6 cell / mL, inoculate into a 500L bioreactor until the cell concentration reaches 2-85×10 6 When cell / mL, the recombinant baculovirus rBac-Hx-STLT-PT was inoculated, and the reactor culture conditions were pH 6.0-6.5, temperature 25-27°C, dissolved oxygen 30-80%, and stirring speed 100-180rpm. Considering the optimal conditions for cell culture, the preferred pH is 6.2, the temperatur...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



