Unlock instant, AI-driven research and patent intelligence for your innovation.

CrgA gene of Blakeslea trispora negative bacteria as well as cloning method and application of crgA gene

A kind of B. trispora and gene technology, applied in the field of genetic engineering

Inactive Publication Date: 2017-08-29
JIANGNAN UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the genetic background of B. trispora has not been clarified, which has become a bottleneck to further increase the production of carotenoids.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CrgA gene of Blakeslea trispora negative bacteria as well as cloning method and application of crgA gene
  • CrgA gene of Blakeslea trispora negative bacteria as well as cloning method and application of crgA gene
  • CrgA gene of Blakeslea trispora negative bacteria as well as cloning method and application of crgA gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1 3

[0030] Example 1 Extraction of B. trispora Genomic DNA.

[0031] Take the cultured B. trispora negative bacteria seed liquid, centrifuge to remove the supernatant, wash twice to obtain mycelia, then add an appropriate amount of liquid nitrogen to grind to white powder, take a small amount of DNA to extract, and refer to the fungal DNA extraction kit instructions.

Embodiment 2 3

[0032] Example 2 Isolation and cloning of the crgA gene of B. trispora negative bacteria.

[0033] According to the sequence of the crgA gene of B. trispora, it was cloned in four segments and primers were designed respectively:

[0034] F1 (up): GGAAATTAAGCTATGCACCGCAGTATAGTC

[0035] F1 (down): AGGAAGGTTTGAACAGAAAACTCTTGTAGC

[0036] F2 (up): GGTAATGTATGTCGGTGTTGGTT

[0037] F2 (down): ACTCGGTTGAAGTGCGATTGTAT

[0038] F3 (up): AGTTAAAGCAATTCAAGCTTCGATTCTA

[0039] F3 (down): CTTTAAGAAATGCAACAAGTAGCAGGTG

[0040] F4 (up): ACAGACGACTGAAGAGATGATTGATGAACT

[0041] F4 (down): TATTTTCATATGGAACAAGATTTGTCTATA

[0042] The PCR reaction system is 50ul, including: Ex Taq enzyme 0.25uL, Ex Taq Buffer 5uL, dNTP Mix 4uL, template extracted from negative bacteria is less than 1ug, upstream / downstream primers (10uM) each 1uL, ddH 2 O up to 50ul; PCR reaction was carried out on the amplification instrument, and the reaction program was as follows: amplification conditions: pre-denatur...

Embodiment 3

[0043] Example 3 takes the PMD-18T plasmid and Escherichia coli DH5ɑ as examples to illustrate the construction process of the prokaryotic expression system.

[0044] The product was identified by nucleic acid electrophoresis and gel-tapping recovery and purification. After purification and recovery, it was connected to the pMD-18T vector to construct a recombinant cloning plasmid, and then transformed into E. coli DH5α for amplification, and positive transformants were picked. LB liquid medium (AMPr) 37°C, 220rpm Cultivate for 10-12h, extract the plasmid, carry out double digestion and verification of the plasmid, and verify that the sequence is correct.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a crgA gene of Blakeslea trispora negative bacteria as well as a gene cloning method and application of the crgA gene and belongs to the technical field of genetic engineering. The gene cloning method disclosed by the invention comprises the following steps: designing four primer pairs according to a crgA gene sequence of Blakeslea trispora positive bacteria and successfully cloning to obtain the crgA gene of the Blakeslea trispora negative bacteria; carrying out homologous alignment analysis on a crgA gene of the Blakeslea trispora positive bacteria and the crgA gene of the Blakeslea trispora negative bacteria; then knocking out the gene, and carrying out comparative analysis a gene knock-out plant on a wild plant in aspects of phenotypic characteristic, key enzyme gene transcription level, carotenoid synthesis level and the like to initially display the effect of the gene as a negative regulatory factor in Blakeslea trispora. According to the crgA gene of the Blakeslea trispora negative bacteria as well as the gene cloning method and application of the crgA gene, disclosed by the invention, the crgA gene of the Blakeslea trispora negative bacteria is cloned by a gene engineering technology, which is beneficial to analyzing a regulation and control mechanism of the crgA gene in the process of producing carotenoid by the Blakeslea trispora and improving the yield of the carotenoid; the crgA gene has a good application prospect.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and mainly relates to a gene of a B. trispora negative fungus regulatory factor crgA, a cloning method and an application. Background technique [0002] Blakeslea trispora belongs to Zygomycetes Zygomycetes Mucorales Mucoralaceae. It is a heterothallic zygomycete, which can be divided into positive bacteria and negative bacteria, and the negative bacteria are the main hosts for the synthesis of carotenoids. B. trispora has a large biomass and high carotenoid production, and is considered to be an ideal microorganism for industrial production of natural β-carotene and lycopene. However, the genetic background of B. trispora has not yet been clarified, which has become a bottleneck to further increase the production of carotenoids. The invention starts with the key regulatory gene for the synthesis of carotenoids of B. trispora, and lays a technical foundation for increasing the output...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/31C12N15/11C12N15/10C12N15/70
CPCC07K14/37C12N15/70
Inventor 罗玮程妙文巩尊洋余晓斌
Owner JIANGNAN UNIV