CrgA gene of Blakeslea trispora negative bacteria as well as cloning method and application of crgA gene
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A kind of B. trispora and gene technology, applied in the field of genetic engineering
Inactive Publication Date: 2017-08-29
JIANGNAN UNIV
View PDF1 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
At present, the genetic background of B. trispora has not been clarified, ...
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1 3
[0030] Example 1 Extraction of B. trispora Genomic DNA.
[0031] Take the cultured B. trispora negative bacteria seed liquid, centrifuge to remove the supernatant, wash twice to obtain mycelia, then add an appropriate amount of liquid nitrogen to grind to white powder, take a small amount of DNA to extract, and refer to the fungal DNA extraction kit instructions.
Embodiment 2 3
[0032] Example 2 Isolation and cloning of the crgA gene of B. trispora negative bacteria.
[0033] According to the sequence of the crgA gene of B. trispora, it was cloned in four segments and primers were designed respectively:
[0034] F1 (up): GGAAATTAAGCTATGCACCGCAGTATAGTC
[0035] F1 (down): AGGAAGGTTTGAACAGAAAACTCTTGTAGC
[0036] F2 (up): GGTAATGTATGTCGGTGTTGGTT
[0037] F2 (down): ACTCGGTTGAAGTGCGATTGTAT
[0038] F3 (up): AGTTAAAGCAATTCAAGCTTCGATTCTA
[0039] F3 (down): CTTTAAGAAATGCAACAAGTAGCAGGTG
[0040] F4 (up): ACAGACGACTGAAGAGATGATTGATGAACT
[0041] F4 (down): TATTTTCATATGGAACAAGATTTGTCTATA
[0042] The PCR reaction system is 50ul, including: Ex Taq enzyme 0.25uL, Ex Taq Buffer 5uL, dNTP Mix 4uL, template extracted from negative bacteria is less than 1ug, upstream / downstream primers (10uM) each 1uL, ddH 2 O up to 50ul; PCR reaction was carried out on the amplification instrument, and the reaction program was as follows: amplification conditions: pre-denatur...
Embodiment 3
[0043] Example 3 takes the PMD-18T plasmid and Escherichia coli DH5ɑ as examples to illustrate the construction process of the prokaryotic expression system.
[0044] The product was identified by nucleic acid electrophoresis and gel-tapping recovery and purification. After purification and recovery, it was connected to the pMD-18T vector to construct a recombinant cloning plasmid, and then transformed into E. coli DH5α for amplification, and positive transformants were picked. LB liquid medium (AMPr) 37°C, 220rpm Cultivate for 10-12h, extract the plasmid, carry out double digestion and verification of the plasmid, and verify that the sequence is correct.
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
PUM
Login to view more
Abstract
The invention discloses a crgA gene of Blakeslea trispora negative bacteria as well as a gene cloning method and application of the crgA gene and belongs to the technical field of genetic engineering. The gene cloning method disclosed by the invention comprises the following steps: designing four primer pairs according to a crgA gene sequence of Blakeslea trispora positive bacteria and successfully cloning to obtain the crgA gene of the Blakeslea trispora negative bacteria; carrying out homologous alignment analysis on a crgA gene of the Blakeslea trispora positive bacteria and the crgA gene of the Blakeslea trispora negative bacteria; then knocking out the gene, and carrying out comparative analysis a gene knock-out plant on a wild plant in aspects of phenotypic characteristic, key enzyme gene transcription level, carotenoid synthesis level and the like to initially display the effect of the gene as a negative regulatory factor in Blakeslea trispora. According to the crgA gene of the Blakeslea trispora negative bacteria as well as the gene cloning method and application of the crgA gene, disclosed by the invention, the crgA gene of the Blakeslea trispora negative bacteria is cloned by a gene engineering technology, which is beneficial to analyzing a regulation and control mechanism of the crgA gene in the process of producing carotenoid by the Blakeslea trispora and improving the yield of the carotenoid; the crgA gene has a good application prospect.
Description
technical field [0001] The invention belongs to the technical field of genetic engineering, and mainly relates to a gene of a B. trispora negative fungus regulatory factor crgA, a cloning method and an application. Background technique [0002] Blakeslea trispora belongs to Zygomycetes Zygomycetes Mucorales Mucoralaceae. It is a heterothallic zygomycete, which can be divided into positive bacteria and negative bacteria, and the negative bacteria are the main hosts for the synthesis of carotenoids. B. trispora has a large biomass and high carotenoid production, and is considered to be an ideal microorganism for industrial production of natural β-carotene and lycopene. However, the genetic background of B. trispora has not yet been clarified, which has become a bottleneck to further increase the production of carotenoids. The invention starts with the key regulatory gene for the synthesis of carotenoids of B. trispora, and lays a technical foundation for increasing the output...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to view more 
Login to view more