Artificially synthesized streptomyces hirsutus ATCC 19091 protein coding gene and its application
A DNA molecule and nucleotide sequence technology, applied in application, genetic engineering, plant genetic improvement, etc., can solve problems such as the inability of wild-type gene sequences
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Streptomyces hirsutus ATCC 19091 was cultured in ATCC Medium 196 medium at a controlled temperature of 26.0°C and 180 rpm for 2 days, the precipitate was collected by centrifugation, and the Streptomyces hirsutus ATCC 19091 genome was extracted and purified with the DNA extraction and purification kit QiAamp Kit (Qiagen, Germany) DNA.
[0026] Streptomyces hirsutus ATCC 19091 genomic DNA was amplified by PCR with Pfu high-fidelity enzyme, and the primers used were
[0027] Shi-F 5'ATCTTGCAAGCTGAGCGCACG 3'
[0028] Shi-R 5'TCATCGTCGCGCTCCGGC 3'
[0029] Since the local GC content of Streptomyces hirsutus ATCC 19091 DNA is close to 80%, betaine at a final concentration of 0.5M was added during amplification. Afterwards, the amplified fragment was treated with Taq polymerase at 72°C for 10 minutes, and base A was added to the 3' end of the DNA. Afterwards, it was connected to the pMD19T-simple (Takara Bao Biological Company, Beijing) cloning vector, and a single clone w...
Embodiment 2
[0031] Through the method of whole gene synthesis, the secondary structure and codon bias of the gene are adjusted, and the GC content of the DNA sequence is adjusted to 40%-60%, so as to achieve high expression in Escherichia coli. Use Primer Premier (http: / / primer3.ut.ee / ) and OPTIMIZER (http: / / genomes.urv.es / OPTIMIZER / ) to design, and ensure that the Tm difference is controlled within 3°C, and the primer length is controlled within 50base , resulting in the following primers:
[0032]
[0033]
[0034] 2mM dNTP mix (2mM each dNTP) 5μl 10×Pfu buffer 5μl Pfu DNA polymerase (10U / μl) 0.5μl ddH2O Bring the total volume of the reaction system to 50 μl
[0035] The prepared PCR reaction system was placed in the Bioer XP cycler gene amplification instrument, and the amplification was carried out according to the following procedures: 98°C for 30s, 65°C for 45s, 72°C for 120s, 35x. The DNA fragment obtained by PCR was gel-cut and purified, ...
Embodiment 3
[0037] Pick a single colony of Escherichia coli containing the expression vector of SEQ ID NO.3 and inoculate it in 10ml of high-pressure sterilized medium: tryptone 10g / L, yeast extract 5g / L, disodium hydrogen phosphate 3.55g / L, phosphoric acid Potassium dihydrogen 3.4g / L, ammonium chloride 2.68 g / L, sodium sulfate 0.71g / L, magnesium sulfate heptahydrate 0.493g / L, ferric chloride hexahydrate 0.027g / L, glycerol 5g / L, glucose 0.8g / L, add kanamycin to 50mg / L. Cultivate overnight at 30°C, 250rpm. The next day, take a 1L Erlenmeyer flask and insert it into 100ml of high-pressure sterilized medium at an inoculation ratio of 1:100: tryptone 10g / L, yeast extract 5g / L, disodium hydrogen phosphate 3.55g / L, phosphoric acid Potassium dihydrogen 3.4g / L, Ammonium chloride 2.68g / L, Sodium sulfate 0.71g / L, Magnesium sulfate heptahydrate 0.493g / L, Ferric chloride hexahydrate 0.027g / L, Glycerin 5g / L, Glucose 0.3g / L, add kanamycin to 50mg / L. Cultivate at 30°C until the cell OD is 5-6, imme...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More