A kit for quantitative detection of tilapia growth hormone based on time-resolved fluorescence immunoassay technology and heterologous antibodies
A time-resolved fluorescence, growth hormone technology, applied in the fields of nano-biology and bioanalytical chemistry, can solve the problem of no literature report on the detection of tilapia GH
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] The expression and purification of recombinant tilapia growth hormone protein comprises the following steps:
[0033] 1. Construction of tilapia recombinant GH protein expression strain
[0034] (1) Amplification of the mature peptide sequence of tilapia GH: according to the published sequence of tilapia GH gene (GenBankno. LOC100534452) and restriction enzymes Bam HI and Hind III Design and synthesize a pair of specific primers (invitrogen company), the upstream primer is 5' CGGGATCCCAGCAGATCACAGACAGCCA 3' total 28bp, which is added before the mature peptide sequence of GH gene BamHI Recognition site for enzyme digestion, the downstream primer is 5' CCCAAGCTTCTACAGAGTGCAGTTTGCTT 3' 29bp in total, which is added after the mature peptide sequence of GH gene Hind III Enzyme recognition site. Take tilapia pituitary, extract total RNA, reverse transcribe into cDNA, and then use KOD Plas Neo high-fidelity PCR enzyme (TOYOBO) to carry out PCR reaction. The reaction con...
Embodiment 2
[0048] 1. Preparation and purification of rabbit polyclonal antibody against recombinant grouper growth hormone
[0049] (1) Purchase 3 New Zealand big-eared rabbits (male, 3-4 months old, weight 2.5-3kg) from the Experimental Animal Center of Guangzhou University of Traditional Chinese Medicine, number the rabbits as A / B / C, and inject A / B oblique belt Grouper recombinant GH protein, C is the control injection of the mixture of the same amount of PBS and adjuvant. For each injection, a certain amount of purified recombinant GH protein from the grouper was diluted with PBS, mixed and emulsified with an equal volume of Freund's adjuvant (Sigam), and injected subcutaneously at multiple points on the back of rabbits for a total of four immunizations. Freund's complete adjuvant was used once, and Freund's incomplete adjuvant was used for the second immunization.
[0050] (2) Immunization scheme: Before the first injection, 2ml of blood was taken as a blank control. The four...
Embodiment 3
[0063] A tilapia GH time-resolved fluorescent immunoassay kit, the preparation method of which is as follows:
[0064] (1) 96-well microwell reaction plate coated with grouper GH-specific single-chain monoclonal antibody: Dilute grouper GH-specific single-chain monoclonal antibody to an appropriate concentration with coating buffer, 4°C Coat overnight to a 96-well microplate, block overnight with blocking buffer, discard the blocking solution, and pat dry for storage. Wherein the coating buffer is: 50mM Tris-HCl buffer at pH 8.0; the blocking buffer is 50mM Tris-HCl buffer at pH 7.8 containing 0.05% NaN3, 1% BSA, and 15% sucrose.
[0065] (2) Purified grouper GH-specific single-chain monoclonal antibody was subjected to Eu 3+ Labeling, Antibodies and Eu 3+ The ratio of markers is 6:1 (mass ratio) as the best ratio. The preparation steps of europium-labeled grouper GH-specific single-chain monoclonal antibody are as follows: Purification and concentration of single-chain mon...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



