Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kit for quantitative detection of tilapia growth hormone based on time-resolved fluorescence immunoassay technology and heterologous antibodies

A time-resolved fluorescence, growth hormone technology, applied in the fields of nano-biology and bioanalytical chemistry, can solve the problem of no literature report on the detection of tilapia GH

Active Publication Date: 2019-02-01
SUN YAT SEN UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, TRFIA technology has been widely used in various clinical detection items, but there is no literature report on using this technology to detect GH in tilapia

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kit for quantitative detection of tilapia growth hormone based on time-resolved fluorescence immunoassay technology and heterologous antibodies
  • A kit for quantitative detection of tilapia growth hormone based on time-resolved fluorescence immunoassay technology and heterologous antibodies
  • A kit for quantitative detection of tilapia growth hormone based on time-resolved fluorescence immunoassay technology and heterologous antibodies

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] The expression and purification of recombinant tilapia growth hormone protein comprises the following steps:

[0033] 1. Construction of tilapia recombinant GH protein expression strain

[0034] (1) Amplification of the mature peptide sequence of tilapia GH: according to the published sequence of tilapia GH gene (GenBankno. LOC100534452) and restriction enzymes Bam HI and Hind III Design and synthesize a pair of specific primers (invitrogen company), the upstream primer is 5' CGGGATCCCAGCAGATCACAGACAGCCA 3' total 28bp, which is added before the mature peptide sequence of GH gene BamHI Recognition site for enzyme digestion, the downstream primer is 5' CCCAAGCTTCTACAGAGTGCAGTTTGCTT 3' 29bp in total, which is added after the mature peptide sequence of GH gene Hind III Enzyme recognition site. Take tilapia pituitary, extract total RNA, reverse transcribe into cDNA, and then use KOD Plas Neo high-fidelity PCR enzyme (TOYOBO) to carry out PCR reaction. The reaction con...

Embodiment 2

[0048] 1. Preparation and purification of rabbit polyclonal antibody against recombinant grouper growth hormone

[0049] (1) Purchase 3 New Zealand big-eared rabbits (male, 3-4 months old, weight 2.5-3kg) from the Experimental Animal Center of Guangzhou University of Traditional Chinese Medicine, number the rabbits as A / B / C, and inject A / B oblique belt Grouper recombinant GH protein, C is the control injection of the mixture of the same amount of PBS and adjuvant. For each injection, a certain amount of purified recombinant GH protein from the grouper was diluted with PBS, mixed and emulsified with an equal volume of Freund's adjuvant (Sigam), and injected subcutaneously at multiple points on the back of rabbits for a total of four immunizations. Freund's complete adjuvant was used once, and Freund's incomplete adjuvant was used for the second immunization.

[0050] (2) Immunization scheme: Before the first injection, 2ml of blood was taken as a blank control. The four...

Embodiment 3

[0063] A tilapia GH time-resolved fluorescent immunoassay kit, the preparation method of which is as follows:

[0064] (1) 96-well microwell reaction plate coated with grouper GH-specific single-chain monoclonal antibody: Dilute grouper GH-specific single-chain monoclonal antibody to an appropriate concentration with coating buffer, 4°C Coat overnight to a 96-well microplate, block overnight with blocking buffer, discard the blocking solution, and pat dry for storage. Wherein the coating buffer is: 50mM Tris-HCl buffer at pH 8.0; the blocking buffer is 50mM Tris-HCl buffer at pH 7.8 containing 0.05% NaN3, 1% BSA, and 15% sucrose.

[0065] (2) Purified grouper GH-specific single-chain monoclonal antibody was subjected to Eu 3+ Labeling, Antibodies and Eu 3+ The ratio of markers is 6:1 (mass ratio) as the best ratio. The preparation steps of europium-labeled grouper GH-specific single-chain monoclonal antibody are as follows: Purification and concentration of single-chain mon...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a tilapia growth hormone quantitative determination kit based on timed-resolved fluoroimmunoassay and heterologous antibody. The kit comprises a micropore reaction plate coated with a saddletail grouper growth hormone specific single chain monoclonal antibody, a recombination tilapia growth hormone protein standard substrate, and an europium-labelled saddletail grouper growth hormone hormone specific single chain monoclonal antibody. Through immunization reaction with a antibody sandwich method, the recombination tilapia growth hormone protein standard substrate or a to-be-detected sample is added in the micropore reaction plate coated with the saddletail grouper growth hormone specific single chain monoclonal antibody, incubation combination is carried out, then board-washing is carried out, then the europium-labelled saddletail grouper growth hormone hormone specific single chain monoclonal antibody is added, incubation combination is carried out, then board-washing is carried out, enhancement liquid is added, and determination is carried out through a multifunctional ELIASA. The kit can be used for detecting growth hormone concentration of growth hormone-containing samples such as tilapia serum or a pituitary lysate, the detection sensitivity can reach 0.225 ng / ml, and the kit provides effective detection means for researching the tilapia growth hormone.

Description

technical field [0001] The invention relates to the fields of bioanalytical chemistry and nano-biotechnology, in particular to a tilapia growth hormone quantitative detection kit based on time-resolved fluorescence immunoassay technology and heterologous antibodies. Background technique [0002] Tilapia belongs to the order Perciformes, family Cichlidae, genus Tilapia ( Tilapia ), native to Africa, has the characteristics of omnivorous, fast growth, high fecundity, and strong adaptability. It is one of the main aquaculture objects in the world and is known as one of the main sources of animal protein in the future. The growth of tilapia is mainly regulated by growth hormone (GH). Fish GH is a protein without glycosyl, which is synthesized and secreted by eosinophilic cells in the distal pituitary gland. It is a single chain with two disulfide bonds in its primary structure. Among fishes of the same order, the amino acid composition homology of GH is about 80%. The full-le...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K16/00G01N33/74
CPCG01N33/533G01N33/577G01N33/582G01N33/74
Inventor 李文笙覃靖凯
Owner SUN YAT SEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com