Method for induction of hypoxia-induced directed differentiation of hematopoietic stem cells into immortalized erythroid progenitor cells
A technology of hematopoietic stem cells and erythroid progenitor cells, which is applied in the field of molecular biology, can solve problems such as leakage, and achieve the effects of improving efficiency, avoiding immunogenic reactions, and improving survival adaptability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1 Hypoxia induces CD34 + Differentiation of hematopoietic progenitor cells into immortalized erythroid progenitor cells
[0042] 1. pFUGW-HRE-E6 / E7 vector construction
[0043] Nine copies of the hypoxia response element Epo HRE sequence (CCGGGTAGCTGGCGTACGTGCTGCAG) were coupled to the CMV minimal promoter, and connected to HPV16 E6 / E7 and SV40 polyadenylation signal (polyA). Then the expression cassette containing 9 copies of HRE sequence (H9), CMV minimal promoter, HPV16 E6 / E7 and SV40 polyadenylation signal (polyA) was cloned into the 2597-4160 position of the lentiviral vector pFUGW (Addgene) During the period, pFUGW-H9-E6 / E7 vector was generated, and the construction map is shown in figure 1 . figure 1 Among them, HRE: hypoxia response element, CMVminPro: cytomegalovirus minimal promoter, human papillomavirus E6 / E7 gene, Ubc is Ubiqutin promoter; EGFP is green fluorescent gene, WPRE is woodchuck hepatitis virus post-transcriptional regulatory element . figure ...
Embodiment 2
[0051] Example 2. Immortalization and differentiation of erythroid progenitor cells into mature red blood cells
[0052] The immortalized erythroid progenitor cells induced under hypoxic conditions were cultured for 100 days after the hypoxic culture was terminated and transferred to the erythrocyte terminal differentiation culture conditions. The rate of obtaining terminal red blood cells is basically close to that of using stem cells to directly differentiate into red blood cells. Specific steps are as follows:
[0053] Transfer the immortalized erythroid progenitor cells to the basal medium at 37°C, 94% N 2 , 5% CO 2 And 1% O 2 Cultured for 8 days under hypoxic conditions. Change the basal medium to differentiation medium (basic medium with 500ug / ml heparin, but without SCF and IL-3). And under normal oxygen supply conditions (95% air and 5% CO 2 ). On the 6th day, the cell concentration is maintained at 1-2×10 5 / ml, add fresh medium to maintain the cell concentration at 1×1...
Embodiment 3
[0059] Example 3. Functional evaluation of induced red blood cells
[0060] The Hemox Analyzer (TCS Scientific Corp) was used to measure the oxygen binding capacity of the red blood cells induced by the present invention, the cultured blood cells were fully oxidized in the air, and then completely deoxygenated in the nitrogen box, and the Clark oxygen electrode probe was used to measure the oxygen tension in aerobic and non-aerobic conditions. The degree of change between oxygen is recorded at the same time as the wavelength value of oxyhemoglobin in dual-wavelength spectrophotometry. Human peripheral whole blood was used as a control. ARCR (Automated Rheoscope and cellanalyzer) is used to measure the degree of deformation.
[0061] Immortalized cells terminate immortalization under aerobic conditions, and differentiate into mature non-nucleated red blood cells-reticulocytes under terminal red blood cell differentiation conditions, which account for about 42% of the total cells. ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


