Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for induction of hypoxia-induced directed differentiation of hematopoietic stem cells into immortalized erythroid progenitor cells

A technology of hematopoietic stem cells and erythroid progenitor cells, which is applied in the field of molecular biology, can solve problems such as leakage, and achieve the effects of improving efficiency, avoiding immunogenic reactions, and improving survival adaptability

Active Publication Date: 2020-04-14
长春力太生物技术有限公司
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The disadvantages of tetracycline induction are: the induction system itself requires long-term use of tetracycline to be toxic to cells, even in the absence of tetracycline induction, there will still be leaky expression of E6 / E7, and the fusion protein tetracycline transcription activator and Hepers Simplex as transcription activators The active factor VP16 of Virus itself can cause immunogenic response as a foreign protein in host cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for induction of hypoxia-induced directed differentiation of hematopoietic stem cells into immortalized erythroid progenitor cells
  • Method for induction of hypoxia-induced directed differentiation of hematopoietic stem cells into immortalized erythroid progenitor cells
  • Method for induction of hypoxia-induced directed differentiation of hematopoietic stem cells into immortalized erythroid progenitor cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 Hypoxia induces CD34 + Differentiation of hematopoietic progenitor cells into immortalized erythroid progenitor cells

[0042] 1. pFUGW-HRE-E6 / E7 vector construction

[0043] Nine copies of the hypoxia response element Epo HRE sequence (CCGGGTAGCTGGCGTACGTGCTGCAG) were coupled to the CMV minimal promoter, and connected to HPV16 E6 / E7 and SV40 polyadenylation signal (polyA). Then the expression cassette containing 9 copies of HRE sequence (H9), CMV minimal promoter, HPV16 E6 / E7 and SV40 polyadenylation signal (polyA) was cloned into the 2597-4160 position of the lentiviral vector pFUGW (Addgene) During the period, pFUGW-H9-E6 / E7 vector was generated, and the construction map is shown in figure 1 . figure 1 Among them, HRE: hypoxia response element, CMVminPro: cytomegalovirus minimal promoter, human papillomavirus E6 / E7 gene, Ubc is Ubiqutin promoter; EGFP is green fluorescent gene, WPRE is woodchuck hepatitis virus post-transcriptional regulatory element . figure ...

Embodiment 2

[0051] Example 2. Immortalization and differentiation of erythroid progenitor cells into mature red blood cells

[0052] The immortalized erythroid progenitor cells induced under hypoxic conditions were cultured for 100 days after the hypoxic culture was terminated and transferred to the erythrocyte terminal differentiation culture conditions. The rate of obtaining terminal red blood cells is basically close to that of using stem cells to directly differentiate into red blood cells. Specific steps are as follows:

[0053] Transfer the immortalized erythroid progenitor cells to the basal medium at 37°C, 94% N 2 , 5% CO 2 And 1% O 2 Cultured for 8 days under hypoxic conditions. Change the basal medium to differentiation medium (basic medium with 500ug / ml heparin, but without SCF and IL-3). And under normal oxygen supply conditions (95% air and 5% CO 2 ). On the 6th day, the cell concentration is maintained at 1-2×10 5 / ml, add fresh medium to maintain the cell concentration at 1×1...

Embodiment 3

[0059] Example 3. Functional evaluation of induced red blood cells

[0060] The Hemox Analyzer (TCS Scientific Corp) was used to measure the oxygen binding capacity of the red blood cells induced by the present invention, the cultured blood cells were fully oxidized in the air, and then completely deoxygenated in the nitrogen box, and the Clark oxygen electrode probe was used to measure the oxygen tension in aerobic and non-aerobic conditions. The degree of change between oxygen is recorded at the same time as the wavelength value of oxyhemoglobin in dual-wavelength spectrophotometry. Human peripheral whole blood was used as a control. ARCR (Automated Rheoscope and cellanalyzer) is used to measure the degree of deformation.

[0061] Immortalized cells terminate immortalization under aerobic conditions, and differentiate into mature non-nucleated red blood cells-reticulocytes under terminal red blood cell differentiation conditions, which account for about 42% of the total cells. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for directionally differentiating hypoxia-induced hematopoietic stem cells into immortalized erythroid progenitor cells. According to the method, a lentivirus expression carrier containing hypoxia reaction elements, CMV-minimal promoters and HPV16E6 / E7 genes is utilized to transfect CD34+ hematopoietic stem cells and induce the hematopoietic stem cells to be directionally differentiated into the immortalized erythroid progenitor cells under a hypoxia condition. The invention further discloses a method for inducing the immortalized erythroid progenitor cells to be differentiated into mature erythrocyte. The erythrocyte induced through the method has the deformability near to normal mature erythrocyte, and the capability of being combined with and releasing oxygen. The oxygen content of hemoglobin can reach 28+ / -2 mmHg, the diameter starts to be reduced 10 minutes to 20 hours after the erythrocyte is infused into a mouse, at the 24 th hour, the cell shows a form of mature erythrocyte, and very good survival adaptability is displayed in the body.

Description

Technical field [0001] The invention discloses a method for inducing immortalized erythroid progenitor cells and belongs to the technical field of molecular biology. Background technique [0002] Blood is an important substance existing in human blood vessels and various tissues. It has the physiological functions of transportation, regulating human body temperature, defense, regulating human osmotic pressure and acid-base balance. The main function of red blood cells is to transport oxygen in and out of carbon dioxide. The main function of white blood cells is to kill bacteria, resist inflammation, and participate in the immune process in the body. Platelets mainly play a hemostatic function in the body. The function of plasma is mainly to nourish, transport lipids, buffer, and form. Osmotic pressure, participate in immunity, participate in blood coagulation and anticoagulant function. Among them, the function of red blood cells to transport oxygen is particularly important, an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N5/078C12N5/0789
CPCC12N5/0641C12N5/0647C12N2506/11
Inventor 宋海鹏叶海波王庆东
Owner 长春力太生物技术有限公司