Primer and method for detecting mycoplasma, application of primer and product applying primer

A technology for mycoplasma and products, applied in the primers and application fields for detecting mycoplasma, can solve the problems of waste of time and scientific research cost of scientific researchers, insufficient sensitivity, poor broad-spectrum, etc., to save scientific research cost and time, expand the scope of application, reduce The effect of testing costs

Inactive Publication Date: 2018-03-16
杭州华安生物技术有限公司
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For relevant scientific researchers, the most serious consequence of mycoplasma contamination is that the contamination unknowingly changes many parameters and experimental results, such as changes in cytokine transcription and expression levels, the effect of viruses on cell viability and proliferation, foreign substances Regulatory effects on cell physiology, etc., reduce the credibility of research results or even get wrong data
And due to pollution, it is necessary to repurchase or resuscitate cells to regain cells that can grow stably and pass on, which causes a huge waste of time and research costs for scientific researchers.
[0006] Commonly used detection methods for mycoplasma include traditional culture method, ELISA method, PCR method, etc. At present, PCR method is the mainstream detection method for mycoplasma, but there are still many problems in the existing PCR detection method for mycoplasma, for example, insufficient sensitivity or specificity Wait
Moreover, the current mainstream kits can only target a certain type of mycoplasma, and their broad-spectrum is poor. They are not suitable for the actual situation that there are actually many kinds of mycoplasma that can contaminate cells, and are not suitable for actual scientific research and laboratory applications.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and method for detecting mycoplasma, application of primer and product applying primer
  • Primer and method for detecting mycoplasma, application of primer and product applying primer
  • Primer and method for detecting mycoplasma, application of primer and product applying primer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Extract the vero cells infected by the following mycoplasma respectively, and use the CTAB method to extract DNA:

[0063] Mycoplasma pirum、Mycoplasma arginini、Mycoplasma fermentans、Mycoplasmahominis、Mycoplasma hyorhinis、Mycoplasma orale、Mycoplasma pulmonis、Mycoplasmasalivarium、Mycoplasma timone、Mycoplasma faucium、Mycoplasma spumans、Mycoplasmaphocicerebrale、Mycoplasma auris、Mycoplasma alkalescens、Mycoplasmaarthritidis、Mycoplasma falconis、Mycoplasma gypis、Mycoplasma subdolum、 Mycoplasma anseris, Mycoplasma canadense, Mycoplasma zalophi, Mycoplasma cloacale, and Mycoplasma buccale.

[0064] Use primers PmyF and PmyR as amplification primers to set up a 20 μl reaction system:

[0065] The primer sequences are shown in the table below:

[0066] Primer

Numbering

5'-3'

PmyF

SEQ ID NO.1

TACATAGGTCGCAAGCGTTATCC

PPML

SEQ ID NO.2

TCTAATCCTGTTTGCTCCCCAC

[0067] The reaction system is shown in the table below:

[0068] ...

Embodiment 2

[0071] Embodiment 2 Sensitivity

[0072] Using Mycoplasma hyorhinis genomic DNA as a template, dilute the DNA template according to the following concentrations: 1μg / mL, 100ng / mL, 10ng / mL, 1ng / mL, 100pg / mL, 10pg / mL, 1pg / mL, 100fg / mL, 10fg / mL mL, 1fg / mL.

[0073] The above-mentioned templates of each concentration were amplified with the primers and amplification methods provided in Example 1, and the results were as follows: figure 2 Shown: lane 1: 1μg / mL; lane 2: 100ng / mL; lane 3: 10ng / mL; lane 4: 1ng / mL; lane 5: 100pg / mL; lane 6: 10pg / mL; mL; lane 8: 100 fg / mL; lane 9: 10 fg / mL; lane 10: 1 fg / mL. Depend on figure 2 It can be seen that the primer can detect the DNA template with a concentration of 10fg / mL, and has high sensitivity.

Embodiment 3

[0075] Establish a 20 μL real-time fluorescent quantitative PCR reaction system, as shown in Table 1:

[0076] Reagent

volume

2×SYBR Premix Ex Taq

10 μL

PmyF (10μM)

0.4μL

PmyR (10μM)

0.4μL

template

2μL

DNA-free ddH 2 O (sterile water)

7.2 μL

[0077] Carry out real-time fluorescent quantitative PCR amplification reaction according to the following procedures:

[0078] Pre-denaturation at 95°C for 30s; denaturation at 95°C for 5s, annealing and extension at 60°C for 30s, a total of 45 cycles; 95°C for 5s, 60°C-95°C, read the fluorescence value every 1min to generate the melting curve.

[0079] Establish a standard curve: use the Mycoplasma hyorhina genomic DNA template series concentration gradient 5ng / μl-0.5fg / μl as the template, take 2ul for each concentration gradient for detection, and use the Mycoplasma hyorhina genomic DNA template corresponding to 10ng-1fg. Standard curve R for standard concentra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
PCR efficiencyaaaaaaaaaa
PCR efficiencyaaaaaaaaaa
Login to View More

Abstract

The invention provides a primer and a method for detecting a mycoplasma, application of the primer and a product applying the primer, and relate to the technical field of biology. The primer for detecting the mycoplasma can simultaneously amplify various mycoplasma 16SrDNA conserved regions. When the primer is applied to mycoplasma detection, various kinds of mycoplasmas can be simultaneously detected; broad spectrum performance is realized; the application range is enlarged. The method for detecting the mycoplasma has the advantages that the detection speed is high; the broad spectrum performance is high; the sensitivity is high; various samples can be simultaneously detected; the detection cost is reduced. The problem that a product and a method which have wide broad spectrum and can simultaneously and fast detect various mycoplasmas are lacked in the prior art is solved.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a primer for detecting mycoplasma and its application, as well as a product and a method thereof. Background technique [0002] Mycoplasma (Mycoplasma), also known as Mycoplasma, is the smallest and simplest prokaryote found so far. The only visible organelle in Mycoplasma is ribosome. [0003] Mycoplasma contamination is one of the most common contaminations in the cell culture process, especially in the culture process of mammalian cells. The main reasons are: Mycoplasma is very small in size, with a diameter of 0.1 μm, which cannot be removed by general filter sterilization, and is difficult to remove under an optical microscope. See its morphological structure clearly; mycoplasma is tenacious and can survive at pH 7.6-8.0, and is resistant to penicillin; in the early stage of mycoplasma contamination, some sensitive cells can see that the growth and proliferation of the sensitive...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/689C12Q1/6851C12Q1/04C12R1/35
CPCC12Q1/6851C12Q1/689C12Q2531/113C12Q2561/113C12Q2563/107
Inventor李帅宋秀丽徐晓勇杨威威
Owner杭州华安生物技术有限公司