Lipase and application thereof

A technology of fatty acid esters and oils, which is applied in application, fat production, fatty acid esterification, etc., can solve the problems of insufficient repeated use times, and achieve improved tolerance, improved enzymatic properties, and specific activity of esterification Improved effect

Active Publication Date: 2018-07-06
WILMAR SHANGHAI BIOTECH RES & DEV CENT
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Immobilized CalB often fails to achieve the expected number of reuses due to factors such as methanol and impurities

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lipase and application thereof
  • Lipase and application thereof
  • Lipase and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0141] Preparation of biodiesel

[0142] The present invention also provides a method of using the polypeptide of the present invention for oil refining, biodiesel preparation, improved feed, food preparation, and pharmaceutical preparation. The method includes the step of using the polypeptide of the present invention to synthesize biodiesel.

[0143] Biodiesel refers to fatty acid monoalkyl esters obtained by esterification and transesterification of fats and oils containing carboxylic acid compounds with organic alcohols (such as methanol, ethanol, glycerol), the most typical being fatty acid methyl esters. In the present invention, the oil containing carboxylic acid group compounds can be animal and vegetable oils known in the art to produce biodiesel, such as edible oils whose acid value exceeds the national standard; including but not limited to crude oil, partially refined oil, catering Waste oils, crude oleic acid, acidified oils, mixtures of PFAD and fatty acid esters...

Embodiment 1

[0205] Embodiment 1: Construction of CalB mutant library

[0206] The amino acid sequence of CALB is derived from the amino acid sequence of wild-type Candida antarctica lipase, and the wild-type amino acid sequence is derived from NCBI, GenBank Accession: ACI06118.1. The mature protein sequence shown in SEQ NO: 2 was selected for expression, the DNA sequence was designed according to the codon preference of Pichia pastoris as shown in SEQ ID NO: 1, and the leader peptide sequence of α-factor was added (from the commercial vector The DNA sequence on pPIC9K) was sent to Shanghai Sangon Bioengineering Co., Ltd. for whole gene synthesis.

[0207] PCR was performed on CalBU / CalBepD using the nucleic acid provided by Gene Synthesis Company as a template, using Ex-Taq DNA polymerase from Takara Company and primers. The primer sequences are as follows:

[0208] CalBU (SEQ NO: 7): aaagaattcccgaaacgatgagatttcc,

[0209] CalBepD (SEQ NO: 8): aaagaattcttatggagtaacaataccagaac.

[0210...

Embodiment 2

[0212] Embodiment 2: the acquisition of CalB mutant

[0213] According to the method described in the literature (Shixuan Wu and Geoffrey J.Letchworth. High efficiency transformation by electroporation of Pichia pastoris preserved with lithium acetate and dithiothreitol. Drug Discovery and Genomic Technologies, 2004, 36 (1): 152-154) to prepare Pichia pastoris GS115 sensory State cells, and then use Bio-Rad's electrotransformer to transfer the CalB mutant vector library into Pichia GS115 according to the preset Pichia transformation program parameters. Transformation-coated MD plates (1.34% YNB, 4×10 -5 % biotin, 2% glucose, 2% agar), placed in a 30°C incubator for 48 hours. The grown colony was transferred to the esterification plate, sealed with a parafilm, and placed in a 30°C incubator until obvious activity was observed. Similarly, the vector pAOCalB of the wild-type gene was transformed into Pichia pastoris, screened for auxotrophy, and the esterification plate was spr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a lipase and an application thereof, and concretely provides a polypeptide. The polypeptide is selected from a polypeptide (1) having a substitution mutation in at least one of the 150th position, the 222th position, the 285th position and the 291th position of an amino acid sequence represented by SEQ ID NO:2, and a polypeptide (2) composed of the polypeptide (1) and a polypeptide for promoting the expression and purification of the polypeptide (1). The invention also provides a polynucleotide sequence for encoding the polypeptide, a nucleic acid construct containingthe polynucleotide sequence, a host cell, and relevant uses. The polypeptide is the lipase, and can be used in oil refining, oil processing, oil chemical engineering, feed improvers, the food industry, biodiesel preparation and the medicine industry.

Description

technical field [0001] The present invention relates to lipase variants and applications thereof. Background technique [0002] Lipase (lipase, EC3.1.1.3), also known as triacylglycerol acyl hydrolase (triacylglycerol), is a kind of long-chain ester compound that can be hydrolyzed in the aqueous phase, and can also catalyze esters in the non-aqueous phase. Enzymes for synthesis or transesterification reactions. Lipase is widely distributed in nature. Lipase has been reported in microorganisms, animals and plants. Among them, microbial lipase resources are the most abundant, so microbial lipase has become the main source of industrial lipase. [0003] Lipase has a wide range of applications, including in oil processing, oil chemical industry, food industry, medicine and health, chemical industry and other fields. In the oil industry, deacidification steps are generally required for oils with high acid value. Commonly used alkali refining deacidification and physical deacidi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/20C12N15/55C12P7/64C11C3/04C11C3/10C11B3/00
CPCC11B3/003C11C3/04C11C3/10C12N9/20C12P7/649C12Y301/01003Y02E50/10
Inventor戴小军徐正军周美凤牛其文
OwnerWILMAR SHANGHAI BIOTECH RES & DEV CENT