CRISPR-Cas nano drug delivery system specifically targeted to FOXO1 gene and application thereof
A nano-drug-loading and specific technology, applied in the fields of genetic engineering and biomedicine
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] Use the CRISPR online tool http: / / crispr.mit.edu / to design the sgRNA sequence targeting the FOXO1 gene, the sequence is as follows sgFOXO1-1: CCGACTTCGAACCCCAGAGCCGT;
[0018] sgFOXO1-2: ATATGCAGAACTCATCAGCCAGG;
[0019] sgFOXO1-3: CACTCGCCCAGATCTACGAATGG.
[0020] Synthesize two complementary single strands of sgRNA, and use BbsI to digest the px330 backbone vector to construct sgRNA onto the CRISPR / Cas system plasmid. The constructed plasmid was transfected into the cells, and after 48 hours, the DNA was extracted for PCR amplification. In order to facilitate the identification of activity, there is a restriction endonuclease BstBI recognition sequence near the cutting site of sgFOXO1-1 designed by the present invention, there is a NdeI recognition sequence near sgFOXO1-2, and there is a BglII recognition sequence near sgFOXO1-2, so the PCR amplification products correspond to After digestion, sgRNA cleavage activity can be efficiently identified. Such as figure ...
Embodiment 2
[0025] Weigh 4g of hydrogenated phospholipids, 2g of cholesterol, 0.5g of (2,3-dioleoyl-propyl)-trimethylamine (DOTAP), 0.5g of dioleoylphosphatidylethanolamine (DOPE), 0.5g of polyethylene glycol 2000- Put distearoylphosphatidylethanolamine and 0.5g C16 Cer-PEG in a 500mL eggplant-shaped bottle, add appropriate amount of absolute ethanol to dissolve. Transfer the solution to a rotary evaporator, remove absolute ethanol under reduced pressure at a temperature of 50°C to obtain a transparent and uniform film, continue vacuuming for about 10 minutes, add about 100 g of 10% sucrose aqueous solution, and rotate for about 30 minutes to obtain lipid suspension. Take it out and place it in a beaker, add 100 nM sgRNA and 200 nMCas mRNA, disperse it with a high-speed disperser for about 10 minutes at 4°C, extrude twice through a high-pressure homogenizer, and pass through a 0.22 μm microporous membrane to obtain a slightly milky Light liposome solution, add double distilled water to m...
Embodiment 3
[0028] Forty db / db mice with spontaneous diabetes and nonalcoholic fatty liver disease were randomly divided into 4 groups, namely FOXO1-Cas nanoliposome group, blank nanomatrix group, positive control group (metformin) and model control group 10 mice in each group; another 10 C57 mice of equal body weight were used as the normal control group. Except for the normal control group and the model control group, the mice in the other groups were administered once every other day for 5 consecutive times; among them, the CRISPR-Cas nano drug delivery system group was injected with CRISPR-Cas containing 10 nM sgRNA through the tail vein of the mice. For the nano-drug loading system, the blank nano-matrix group was injected with the same amount of the blank nano-drug loading system through the tail vein of the mice, and the positive control group was given 8 mg / kg metformin by intragastric administration. Twelve hours after the last administration, the orbital blood was collected to d...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


