Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

CRISPR-Cas nano drug delivery system specifically targeted to FOXO1 gene and application thereof

A nano-drug-loading and specific technology, applied in the fields of genetic engineering and biomedicine

Inactive Publication Date: 2018-07-10
ZHEJIANG ACAD OF MEDICAL SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But the effect of enhanced FOXO1 activity on insulin resistance is twofold

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CRISPR-Cas nano drug delivery system specifically targeted to FOXO1 gene and application thereof
  • CRISPR-Cas nano drug delivery system specifically targeted to FOXO1 gene and application thereof
  • CRISPR-Cas nano drug delivery system specifically targeted to FOXO1 gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Use the CRISPR online tool http: / / crispr.mit.edu / to design the sgRNA sequence targeting the FOXO1 gene, the sequence is as follows sgFOXO1-1: CCGACTTCGAACCCCAGAGCCGT;

[0018] sgFOXO1-2: ATATGCAGAACTCATCAGCCAGG;

[0019] sgFOXO1-3: CACTCGCCCAGATCTACGAATGG.

[0020] Synthesize two complementary single strands of sgRNA, and use BbsI to digest the px330 backbone vector to construct sgRNA onto the CRISPR / Cas system plasmid. The constructed plasmid was transfected into the cells, and after 48 hours, the DNA was extracted for PCR amplification. In order to facilitate the identification of activity, there is a restriction endonuclease BstBI recognition sequence near the cutting site of sgFOXO1-1 designed by the present invention, there is a NdeI recognition sequence near sgFOXO1-2, and there is a BglII recognition sequence near sgFOXO1-2, so the PCR amplification products correspond to After digestion, sgRNA cleavage activity can be efficiently identified. Such as figure ...

Embodiment 2

[0025] Weigh 4g of hydrogenated phospholipids, 2g of cholesterol, 0.5g of (2,3-dioleoyl-propyl)-trimethylamine (DOTAP), 0.5g of dioleoylphosphatidylethanolamine (DOPE), 0.5g of polyethylene glycol 2000- Put distearoylphosphatidylethanolamine and 0.5g C16 Cer-PEG in a 500mL eggplant-shaped bottle, add appropriate amount of absolute ethanol to dissolve. Transfer the solution to a rotary evaporator, remove absolute ethanol under reduced pressure at a temperature of 50°C to obtain a transparent and uniform film, continue vacuuming for about 10 minutes, add about 100 g of 10% sucrose aqueous solution, and rotate for about 30 minutes to obtain lipid suspension. Take it out and place it in a beaker, add 100 nM sgRNA and 200 nMCas mRNA, disperse it with a high-speed disperser for about 10 minutes at 4°C, extrude twice through a high-pressure homogenizer, and pass through a 0.22 μm microporous membrane to obtain a slightly milky Light liposome solution, add double distilled water to m...

Embodiment 3

[0028] Forty db / db mice with spontaneous diabetes and nonalcoholic fatty liver disease were randomly divided into 4 groups, namely FOXO1-Cas nanoliposome group, blank nanomatrix group, positive control group (metformin) and model control group 10 mice in each group; another 10 C57 mice of equal body weight were used as the normal control group. Except for the normal control group and the model control group, the mice in the other groups were administered once every other day for 5 consecutive times; among them, the CRISPR-Cas nano drug delivery system group was injected with CRISPR-Cas containing 10 nM sgRNA through the tail vein of the mice. For the nano-drug loading system, the blank nano-matrix group was injected with the same amount of the blank nano-drug loading system through the tail vein of the mice, and the positive control group was given 8 mg / kg metformin by intragastric administration. Twelve hours after the last administration, the orbital blood was collected to d...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a CRISPR-Cas nano drug delivery system specifically targeted to an FOXO1 gene and an application thereof, and belongs to the technical fields of genetic engineering and biological medicine. On one hand, the invention provides the CRISPR-Cas nano drug delivery system specifically targeted to the FOXO1 gene; on the other hand, the invention provides the application of the system in preparation of drugs for treatment of metabolic diseases.

Description

technical field [0001] The invention belongs to the technical fields of genetic engineering and biomedicine, and in particular relates to a CRISPR-Cas nano drug delivery system specifically targeting the FOXO1 gene and its application. Background technique [0002] Insulin resistance is one of the important pathological features of patients with metabolic syndrome (including fatty liver and type 2 diabetes). In these patients, the function of secreting insulin from pancreatic β cells may be normal or even high, but the target cells of insulin action cannot recognize insulin. , causing a series of metabolic disorders. Modern studies have shown that insulin resistance interacts with forkhead box O (FOXO). FOXO is a subgroup of the Forkhead protein family and is an important class of transcription factors. Among them, FOXO1 is a member of the FOXO family, which can widely act on adipocytes, cardiomyocytes, liver cells, pancreatic β cells and other cells, participate in the re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K9/127A61K31/7105A61K47/26A61K48/00A61P5/50
CPCA61K9/127A61K31/7105A61K47/26A61K48/005
Inventor 王志远张欢欢余陈欢俞文英方杰谢珲钟宇森应华忠
Owner ZHEJIANG ACAD OF MEDICAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com