Aspergillus oryzae capable of reducing accumulation of by-product in synthesis process of malic acid and application of aspergillus oryzae
A technology of Aspergillus oryzae and malic acid, which is applied in the field of genetic engineering, can solve the problems such as no by-product regulation of malic acid, and achieve the effect of simple and efficient metabolic engineering methods and strategies.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Construction of embodiment 1 overexpression vector
[0026] Primers were designed according to the gene sequences of FUM I, Ropyc and sfc1p published on NCBI:
[0027] fum-1 ATGTTGAGATTTACCAATTGTAGTTGCAAG
[0028] fum-2TTATTTAGGACCTAGCATGTGTTCAGGAAC
[0029] pyc-1 ATGCCTGCTGCACCAGTACGTGAAC
[0030] pyc-2TTAGGCTTCCTCTTTGACAACCTTG
[0031] sfc1p-1 ATGTCTCAAAAAAAAGAAGGC
[0032] sfc1p-2 TACTTTAATGGCTTTGGCT
[0033] Target genes were amplified by PCR using the genomes of Saccharomyces cerevisiae and Rhizopus oryzae as templates. Among them, the extraction method of Saccharomyces cerevisiae genome is the method of Genome Extraction Kit for Rhizopus cerevisiae, and the method for extracting the genome of Rhizopus oryzae is the method of Genome Extraction Kit for Rhizopus oryzae Genome. The fusion product of the starting plasmid pMD-ETPBG and the target gene with the promoter and terminator derived from Aspergillus oryzae was cut with Not I and Asc I enzymes, and the tar...
Embodiment 2
[0034] Embodiment 2 Aspergillus oryzae protoplast transforms and the screening of transformant
[0035] The Aspergillus oryzae recombination method is the protoplast transformation method, and the protoplast preparation method refers to the literature Brown, S.H., Bashkirova, L., Berka, R., Chandler, T., Doty, T., McCall, K., McCulloch, M., McFarland, S., Thompson, S., Yaver, D., Berry, A., 2013. Metabolic engineering of Aspergillusoryzae NRRL 3488 for increased production of L-malic acid. Appl Microb Biotech. 97, 8903-8912. For the protoplast transformation method, see the literature Blumhoff, M., Steiger, M.G., Marx, H., Mattanovich, D., Sauer, M., 2013. Six novel constitutive promoters formetabolic engineering of Aspergillus niger. Appl Microb Biotech.97, 259-267.
[0036] The host bacterium used for transformation is A.oryzae GAA, and the transformation product is coated with a bleomycin-resistant plate. The genome of the regenerated protoplast strain was extracted for PC...
Embodiment 3
[0037] Embodiment 3 Aspergillus oryzae fermentation produces L-malic acid
[0038] The spores of Aspergillus oryzae cultured at 34°C for 3-5 days were eluted with 0.05% Tween 80, and the mycelium was removed by filtration with mica cloth. The final concentration of spores in Aspergillus oryzae shake flask seed medium was 1×10 7 cells / mL, cultured at 30°C, 200rpm for 14h, transferred to the fermentation medium with a 10% inoculum size, and fermented at 30°C, 200rpm until the end of sugar consumption.
[0039] Heterologous expression of Saccharomyces cerevisiae fumarase encoding gene FUM1, Rhizopus oryzae pyruvate carboxylase encoding gene Ropyc and Saccharomyces cerevisiae succinate-fumarate mitochondrial transporter gene sfc1p in genetically engineered bacteria A.oryzae GAA , the obtained recombinant bacterium GAAFPS can use 130g cornstarch to synthesize 105.3g malic acid, 0.21g fumaric acid and 3.8g succinic acid through 102h shake flask fermentation, compared with the startin...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

