Aspergillus oryzae capable of reducing accumulation of by-product in synthesis process of malic acid and application of aspergillus oryzae

A technology of Aspergillus oryzae and malic acid, which is applied in the field of genetic engineering, can solve the problems such as no by-product regulation of malic acid, and achieve the effect of simple and efficient metabolic engineering methods and strategies.

Active Publication Date: 2018-10-12
HANGZHOU BIOKING BIOCHEM ENG
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, during the fermentation process, the by-products fumaric acid and succinic acid have been accumulated along with the synthesis of malic acid, especially succinic acid, and there is no report on the regulation of by-products in the process of malic acid synthesis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aspergillus oryzae capable of reducing accumulation of by-product in synthesis process of malic acid and application of aspergillus oryzae

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Construction of embodiment 1 overexpression vector

[0026] Primers were designed according to the gene sequences of FUM I, Ropyc and sfc1p published on NCBI:

[0027] fum-1 ATGTTGAGATTTACCAATTGTAGTTGCAAG

[0028] fum-2TTATTTAGGACCTAGCATGTGTTCAGGAAC

[0029] pyc-1 ATGCCTGCTGCACCAGTACGTGAAC

[0030] pyc-2TTAGGCTTCCTCTTTGACAACCTTG

[0031] sfc1p-1 ATGTCTCAAAAAAAAGAAGGC

[0032] sfc1p-2 TACTTTAATGGCTTTGGCT

[0033] Target genes were amplified by PCR using the genomes of Saccharomyces cerevisiae and Rhizopus oryzae as templates. Among them, the extraction method of Saccharomyces cerevisiae genome is the method of Genome Extraction Kit for Rhizopus cerevisiae, and the method for extracting the genome of Rhizopus oryzae is the method of Genome Extraction Kit for Rhizopus oryzae Genome. The fusion product of the starting plasmid pMD-ETPBG and the target gene with the promoter and terminator derived from Aspergillus oryzae was cut with Not I and Asc I enzymes, and the tar...

Embodiment 2

[0034] Embodiment 2 Aspergillus oryzae protoplast transforms and the screening of transformant

[0035] The Aspergillus oryzae recombination method is the protoplast transformation method, and the protoplast preparation method refers to the literature Brown, S.H., Bashkirova, L., Berka, R., Chandler, T., Doty, T., McCall, K., McCulloch, M., McFarland, S., Thompson, S., Yaver, D., Berry, A., 2013. Metabolic engineering of Aspergillusoryzae NRRL 3488 for increased production of L-malic acid. Appl Microb Biotech. 97, 8903-8912. For the protoplast transformation method, see the literature Blumhoff, M., Steiger, M.G., Marx, H., Mattanovich, D., Sauer, M., 2013. Six novel constitutive promoters formetabolic engineering of Aspergillus niger. Appl Microb Biotech.97, 259-267.

[0036] The host bacterium used for transformation is A.oryzae GAA, and the transformation product is coated with a bleomycin-resistant plate. The genome of the regenerated protoplast strain was extracted for PC...

Embodiment 3

[0037] Embodiment 3 Aspergillus oryzae fermentation produces L-malic acid

[0038] The spores of Aspergillus oryzae cultured at 34°C for 3-5 days were eluted with 0.05% Tween 80, and the mycelium was removed by filtration with mica cloth. The final concentration of spores in Aspergillus oryzae shake flask seed medium was 1×10 7 cells / mL, cultured at 30°C, 200rpm for 14h, transferred to the fermentation medium with a 10% inoculum size, and fermented at 30°C, 200rpm until the end of sugar consumption.

[0039] Heterologous expression of Saccharomyces cerevisiae fumarase encoding gene FUM1, Rhizopus oryzae pyruvate carboxylase encoding gene Ropyc and Saccharomyces cerevisiae succinate-fumarate mitochondrial transporter gene sfc1p in genetically engineered bacteria A.oryzae GAA , the obtained recombinant bacterium GAAFPS can use 130g cornstarch to synthesize 105.3g malic acid, 0.21g fumaric acid and 3.8g succinic acid through 102h shake flask fermentation, compared with the startin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses aspergillus oryzae capable of reducing accumulation of a by-product in a synthesis process of aspergillus oryzae and an application of the aspergillus oryzae, and belongs to the field of genetic engineering. According to the invention, on the basis of A.oryzae GAA, over-expression of a fumarase coding gene derived from saccharomyces cerevisiae, a pyruvate carboxylase codinggene derived from rhizopus oryzae, a succinic acid-fumaric acid mitochondria transport protein coding gene derived from saccharomyces cerevisiae is implemented, so that conversion of fumaric acid andpyruvic acid in cytoplasm and mitochondria towards the malic acid and material exchange of cytoplasm and mitochondria are further enhanced. As for the finally obtained recombinant bacterium A.oryzaeCMPFS, a yield of L-malic acid undergoing shake-flask fermentation for 102h reaches 105.3g / L, concentration of succinic acid is 3.8g / L and concentration of fumaric acid is 0.21g / L; therefore, the concentration of the by-product is obviously reduced and product yield is improved; and a foundation is laid for production of the L-malic acid which is higher in purity through further metabolic transformation.

Description

technical field [0001] The invention relates to an aspergillus oryzae capable of reducing the accumulation of by-products in the synthesis process of malic acid and an application thereof, belonging to the field of genetic engineering. Background technique [0002] As one of the 12 priority bio-based platform compounds identified by the U.S. Department of Energy, malic acid has been widely used in food, health care products, chemicals, agriculture, cosmetics and medicine. The malic acid synthesized by the traditional chemical synthesis method is all DL-type. Since the L-type malic acid has higher nutritional value, the use of microbial fermentation to produce L-malic acid has attracted more and more researchers' attention in recent years. . [0003] Aspergillus oryzae, as a "generally regarded as safe" (GRAS) safe strain, has been used in food, feed, acid production, winemaking and other fermentation industries as early as 1,000 years ago, and is an ideal eukaryotic express...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/15C12P7/46C12R1/69
CPCC07K14/395C12N9/88C12N9/93C12P7/46C12Y402/01002C12Y604/01001
Inventor刘龙陈坚刘晶晶堵国成李江华
OwnerHANGZHOU BIOKING BIOCHEM ENG